ID: 1039455018

View in Genome Browser
Species Human (GRCh38)
Location 8:37700367-37700389
Sequence GCCCTTGGTGCTGGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039455018_1039455029 18 Left 1039455018 8:37700367-37700389 CCCAGGACCCCAGCACCAAGGGC No data
Right 1039455029 8:37700408-37700430 AGCGCAGTCCTGGAGCCCGGCGG No data
1039455018_1039455028 15 Left 1039455018 8:37700367-37700389 CCCAGGACCCCAGCACCAAGGGC No data
Right 1039455028 8:37700405-37700427 AGCAGCGCAGTCCTGGAGCCCGG No data
1039455018_1039455033 27 Left 1039455018 8:37700367-37700389 CCCAGGACCCCAGCACCAAGGGC No data
Right 1039455033 8:37700417-37700439 CTGGAGCCCGGCGGCCTGGCGGG No data
1039455018_1039455026 8 Left 1039455018 8:37700367-37700389 CCCAGGACCCCAGCACCAAGGGC No data
Right 1039455026 8:37700398-37700420 AGACTCCAGCAGCGCAGTCCTGG No data
1039455018_1039455032 26 Left 1039455018 8:37700367-37700389 CCCAGGACCCCAGCACCAAGGGC No data
Right 1039455032 8:37700416-37700438 CCTGGAGCCCGGCGGCCTGGCGG No data
1039455018_1039455030 23 Left 1039455018 8:37700367-37700389 CCCAGGACCCCAGCACCAAGGGC No data
Right 1039455030 8:37700413-37700435 AGTCCTGGAGCCCGGCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039455018 Original CRISPR GCCCTTGGTGCTGGGGTCCT GGG (reversed) Intergenic