ID: 1039457615

View in Genome Browser
Species Human (GRCh38)
Location 8:37717918-37717940
Sequence TGCATGGTCCCTGCCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039457615_1039457620 -5 Left 1039457615 8:37717918-37717940 CCAGAAAAGGCAGGGACCATGCA No data
Right 1039457620 8:37717936-37717958 ATGCAAAGGGGTCCGAAAAATGG No data
1039457615_1039457623 7 Left 1039457615 8:37717918-37717940 CCAGAAAAGGCAGGGACCATGCA No data
Right 1039457623 8:37717948-37717970 CCGAAAAATGGGACCTTCAGTGG No data
1039457615_1039457621 -4 Left 1039457615 8:37717918-37717940 CCAGAAAAGGCAGGGACCATGCA No data
Right 1039457621 8:37717937-37717959 TGCAAAGGGGTCCGAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039457615 Original CRISPR TGCATGGTCCCTGCCTTTTC TGG (reversed) Intergenic