ID: 1039458070

View in Genome Browser
Species Human (GRCh38)
Location 8:37721065-37721087
Sequence CAGTATGAGGATTTGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039458070_1039458079 11 Left 1039458070 8:37721065-37721087 CCACCTCCCAAATCCTCATACTG No data
Right 1039458079 8:37721099-37721121 CGTCCCCACCTGGGCTCCCCTGG No data
1039458070_1039458080 12 Left 1039458070 8:37721065-37721087 CCACCTCCCAAATCCTCATACTG No data
Right 1039458080 8:37721100-37721122 GTCCCCACCTGGGCTCCCCTGGG No data
1039458070_1039458077 2 Left 1039458070 8:37721065-37721087 CCACCTCCCAAATCCTCATACTG No data
Right 1039458077 8:37721090-37721112 CCATCACCTCGTCCCCACCTGGG No data
1039458070_1039458075 1 Left 1039458070 8:37721065-37721087 CCACCTCCCAAATCCTCATACTG No data
Right 1039458075 8:37721089-37721111 ACCATCACCTCGTCCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039458070 Original CRISPR CAGTATGAGGATTTGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr