ID: 1039458092

View in Genome Browser
Species Human (GRCh38)
Location 8:37721158-37721180
Sequence CTACACTTTCAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039458092_1039458101 9 Left 1039458092 8:37721158-37721180 CCCTCCCCATTCTGAAAGTGTAG No data
Right 1039458101 8:37721190-37721212 TGGAAAAGAACCAAGGGCCCCGG No data
1039458092_1039458102 10 Left 1039458092 8:37721158-37721180 CCCTCCCCATTCTGAAAGTGTAG No data
Right 1039458102 8:37721191-37721213 GGAAAAGAACCAAGGGCCCCGGG No data
1039458092_1039458100 3 Left 1039458092 8:37721158-37721180 CCCTCCCCATTCTGAAAGTGTAG No data
Right 1039458100 8:37721184-37721206 AGAATGTGGAAAAGAACCAAGGG No data
1039458092_1039458099 2 Left 1039458092 8:37721158-37721180 CCCTCCCCATTCTGAAAGTGTAG No data
Right 1039458099 8:37721183-37721205 AAGAATGTGGAAAAGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039458092 Original CRISPR CTACACTTTCAGAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr