ID: 1039459620

View in Genome Browser
Species Human (GRCh38)
Location 8:37732648-37732670
Sequence TATAATGAACACATGCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039459620_1039459623 2 Left 1039459620 8:37732648-37732670 CCATGATGCATGTGTTCATTATA No data
Right 1039459623 8:37732673-37732695 GATTGTGGTAATGGCTTCACAGG No data
1039459620_1039459622 -7 Left 1039459620 8:37732648-37732670 CCATGATGCATGTGTTCATTATA No data
Right 1039459622 8:37732664-37732686 CATTATACTGATTGTGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039459620 Original CRISPR TATAATGAACACATGCATCA TGG (reversed) Intergenic
No off target data available for this crispr