ID: 1039463578

View in Genome Browser
Species Human (GRCh38)
Location 8:37765811-37765833
Sequence GTACAACTCAACCACCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039463578_1039463584 9 Left 1039463578 8:37765811-37765833 CCATCCTGGTGGTTGAGTTGTAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1039463584 8:37765843-37765865 AGGGTGGTTGACTTTAGATTGGG 0: 1
1: 0
2: 1
3: 12
4: 269
1039463578_1039463581 -10 Left 1039463578 8:37765811-37765833 CCATCCTGGTGGTTGAGTTGTAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1039463581 8:37765824-37765846 TGAGTTGTACAGCAGTTTTAGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1039463578_1039463582 -7 Left 1039463578 8:37765811-37765833 CCATCCTGGTGGTTGAGTTGTAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1039463582 8:37765827-37765849 GTTGTACAGCAGTTTTAGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 90
1039463578_1039463583 8 Left 1039463578 8:37765811-37765833 CCATCCTGGTGGTTGAGTTGTAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1039463583 8:37765842-37765864 TAGGGTGGTTGACTTTAGATTGG 0: 1
1: 0
2: 0
3: 6
4: 85
1039463578_1039463585 14 Left 1039463578 8:37765811-37765833 CCATCCTGGTGGTTGAGTTGTAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1039463585 8:37765848-37765870 GGTTGACTTTAGATTGGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 92
1039463578_1039463586 15 Left 1039463578 8:37765811-37765833 CCATCCTGGTGGTTGAGTTGTAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1039463586 8:37765849-37765871 GTTGACTTTAGATTGGGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039463578 Original CRISPR GTACAACTCAACCACCAGGA TGG (reversed) Intronic
900607517 1:3530488-3530510 GTTCAAAGCAACCACCTGGAGGG + Intronic
902869847 1:19307383-19307405 GTACAACGCCACCACCCGGCAGG - Exonic
903350132 1:22711860-22711882 GTACCACTCGACCCCCAGGGGGG + Intronic
904172268 1:28599672-28599694 AGAGAACTCATCCACCAGGAAGG + Intronic
904505946 1:30954141-30954163 GGTCAACTCAACAACCTGGAAGG + Intronic
907862588 1:58367887-58367909 GCACAACTAAAGCACCAGGTTGG + Intronic
909952704 1:81738381-81738403 GGACAGCTCAACAACAAGGAAGG + Intronic
912126772 1:106549035-106549057 GAACAAATGCACCACCAGGATGG + Intergenic
913372284 1:118114192-118114214 GTACAACTCCCCCAACACGATGG + Intronic
913929917 1:124944191-124944213 GAACAACTCTCCCAACAGGAAGG + Intergenic
918669122 1:187191483-187191505 GTACAATTCAGCAACCACGAGGG - Intergenic
923369728 1:233297827-233297849 GAACACCTGAACCAGCAGGAAGG + Intergenic
1065072412 10:22039594-22039616 CTACAATTTAACCACCAGGTAGG + Intergenic
1065755127 10:28924064-28924086 GCAGAATTCAACCAGCAGGAAGG - Intergenic
1068522810 10:58095780-58095802 GTAAAACTTAGCCACCAAGAGGG + Intergenic
1070386989 10:75934660-75934682 GTACCACTCGGCCAGCAGGATGG + Intronic
1073663600 10:105505457-105505479 GAACCCCTCAGCCACCAGGATGG - Intergenic
1078008233 11:7548618-7548640 GGACAACTCTACCTCAAGGAAGG - Intronic
1078931672 11:15917106-15917128 TTACTACTCTACCACTAGGATGG - Intergenic
1079623880 11:22592114-22592136 GTACAAAATAACCACCATGAAGG - Intergenic
1082654671 11:55839182-55839204 ATACAATACAACCACCAGCATGG - Exonic
1084188907 11:67490104-67490126 GTGCCACTTATCCACCAGGAGGG + Exonic
1084893183 11:72247002-72247024 GTGCACCTCACACACCAGGAGGG - Intergenic
1089302125 11:117505004-117505026 GTGCAACCCAACAACCAGGATGG - Exonic
1090979391 11:131704130-131704152 GGATAACTCAATCACCAGGCTGG + Intronic
1093099052 12:15005294-15005316 GTACACAACAACCACCTGGAAGG - Intergenic
1097160059 12:57039745-57039767 GTGCAGCACAACCACCTGGAGGG + Intronic
1098243976 12:68497293-68497315 ATAGAACCCAACCAGCAGGATGG + Intergenic
1099328183 12:81246172-81246194 GTACAACACATCCTACAGGAGGG - Intronic
1104327991 12:127818335-127818357 ATAAAACACAAGCACCAGGAGGG + Intergenic
1107990592 13:45815657-45815679 TTACATCTCATCCACTAGGAAGG + Intronic
1108256127 13:48612657-48612679 ATACTTCACAACCACCAGGATGG - Intergenic
1108256234 13:48613737-48613759 ATACATCACAACCACTAGGATGG - Intergenic
1110535824 13:76649645-76649667 ATATTACCCAACCACCAGGAAGG - Intergenic
1115373216 14:32643200-32643222 GTAAAACCCATCTACCAGGATGG + Intronic
1117191566 14:53297542-53297564 GGACAACTCTTCCACCAGGGAGG - Intergenic
1125196762 15:37056505-37056527 CAACAAGTCAGCCACCAGGACGG + Intronic
1126776300 15:52103562-52103584 GTACAAAACTAACACCAGGATGG - Intergenic
1127713523 15:61625021-61625043 GCACAACTCAACAACGAGGCAGG + Intergenic
1128680508 15:69648143-69648165 GTGCAACTCAAGTCCCAGGATGG - Intergenic
1138190146 16:55007964-55007986 GTAGAACTCATCCACGAGCACGG - Intergenic
1138347361 16:56328305-56328327 CTCCAACTCAACCAGCAGGAAGG - Intronic
1140925758 16:79581768-79581790 GTACAACTTAATCATCAGTACGG - Intergenic
1141016814 16:80458626-80458648 TTACAACTCTCCCACCAGGAAGG + Intergenic
1146902586 17:36598279-36598301 GTACCACTCACCCACCAGGCTGG + Intronic
1146917039 17:36684712-36684734 GTACAATTCTCCCACAAGGATGG + Intergenic
1157098409 18:44708184-44708206 GGACACTTGAACCACCAGGAGGG - Intronic
1157409013 18:47448171-47448193 GTACAACTGCAGGACCAGGAAGG + Intergenic
1163035675 19:14567564-14567586 GGACAAATCAACCTTCAGGAGGG + Intronic
1163216834 19:15885327-15885349 GGACAGCTCCACCACCAGGCTGG + Intronic
1163793094 19:19319860-19319882 GTAGAAAGCAACCTCCAGGAAGG + Intronic
1164944255 19:32279794-32279816 GTACTTCACAACCACTAGGATGG + Intergenic
927951011 2:27169513-27169535 CTACAACACACCCACCAGAATGG + Intergenic
929125788 2:38521697-38521719 ATACATCACAACCACCTGGAGGG + Intergenic
929731343 2:44496515-44496537 GTACAAGTCACCTACAAGGATGG - Intronic
936153802 2:110035679-110035701 GTCCCTCTCAACCACCAGTATGG + Intergenic
936190883 2:110335736-110335758 GTCCCTCTCAACCACCAGTATGG - Intergenic
937379913 2:121367286-121367308 GGCCAACTCTACCATCAGGAAGG - Intronic
937835474 2:126466824-126466846 GTACAACTCAATGCCCAGCAGGG - Intergenic
943302582 2:186222717-186222739 GTACCAATTAACCAACAGGAAGG + Intergenic
948582223 2:238996347-238996369 GGACTCCTCAGCCACCAGGAAGG + Intergenic
1170092856 20:12610841-12610863 GTAAAACTAAAGCAGCAGGAAGG - Intergenic
1170383742 20:15793230-15793252 GTGCATCACAATCACCAGGAAGG + Intronic
1173670104 20:44793035-44793057 TTAAAATTCAACCACCAGGATGG + Intronic
1174742630 20:53030250-53030272 GCAAAAATCAACCACCAGGTGGG - Intronic
1175636083 20:60585451-60585473 GTACCCCCCAACCACTAGGATGG + Intergenic
1185371464 22:50462808-50462830 GGAGACCTCAGCCACCAGGAAGG + Intronic
949106795 3:209503-209525 GAACAACTAGACCACTAGGAAGG - Intronic
952580322 3:34825066-34825088 ATACTACTCAGCCACCTGGATGG + Intergenic
957463879 3:80559906-80559928 GTGCAGCTCAACCTCCAGGCCGG - Intergenic
959729710 3:109587192-109587214 GTACAACTGAGCCTTCAGGATGG - Intergenic
961145951 3:124593448-124593470 GTGCACCACAACCACCTGGAGGG - Intronic
965560268 3:170055426-170055448 GTATGACTCAACCACCAGAGAGG - Intronic
966194298 3:177298071-177298093 GTAGAAATCACCCAGCAGGAGGG - Intergenic
982212883 4:153055138-153055160 GTAGAATTAAAACACCAGGAAGG + Intergenic
982549533 4:156780461-156780483 GTATCACTCAACCACCATTAAGG + Intronic
983310426 4:166053415-166053437 GTAGAATGCAAGCACCAGGAGGG + Intronic
983422392 4:167535935-167535957 CTAAAACTCAACCCACAGGATGG - Intergenic
988598397 5:32616590-32616612 GTTCAACTGAACCACCAAGGAGG - Intergenic
992482971 5:77169361-77169383 GTACATCACAATCACCTGGAGGG + Intergenic
995722583 5:115151789-115151811 CTACAACTCGACTCCCAGGAAGG + Intronic
995999260 5:118339279-118339301 GTACAACAGAATCACCTGGAGGG - Intergenic
996494396 5:124137166-124137188 TTACAATTCAAATACCAGGAAGG - Intergenic
997758360 5:136421522-136421544 TCAGAACTCAACAACCAGGATGG - Intergenic
998586713 5:143434618-143434640 GTACAACTAAAGCCCGAGGAGGG + Intronic
999163169 5:149522794-149522816 CTACAACTCTACAACAAGGATGG + Intronic
999429350 5:151512487-151512509 GTCCATCTCCTCCACCAGGATGG + Exonic
999714671 5:154350882-154350904 GTACACCAGAATCACCAGGAGGG + Intronic
1003812939 6:9804836-9804858 GTTAAACTCAACCACTTGGAGGG + Intronic
1007399972 6:41597984-41598006 GCACCCCTCAACCACCAGGGAGG + Intronic
1009935587 6:70231043-70231065 GTGCAGCAGAACCACCAGGAGGG + Intronic
1015438344 6:133217159-133217181 CTACTACACAACCACAAGGATGG - Intergenic
1016460813 6:144278764-144278786 GTGCAACTCATCCGACAGGAAGG - Intergenic
1016834858 6:148466902-148466924 CTACAAGTTCACCACCAGGAAGG - Intronic
1027375315 7:77542311-77542333 GTACAACTCAAGGAGCAGGCTGG - Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1032796964 7:135285567-135285589 CTACAAATGTACCACCAGGACGG + Intergenic
1034953058 7:155313925-155313947 GTTTAACGCATCCACCAGGAGGG + Intergenic
1035187945 7:157140244-157140266 GTATATCACAACCACCAGGTAGG + Intronic
1035310850 7:157967721-157967743 GAAAAACTCAACAAACAGGAGGG + Intronic
1037486774 8:19355282-19355304 GTGCATTTCCACCACCAGGAAGG - Intronic
1037506191 8:19531992-19532014 GAAAAACTCAACCAGCAGGCAGG - Intronic
1039463578 8:37765811-37765833 GTACAACTCAACCACCAGGATGG - Intronic
1042688576 8:71469954-71469976 GAACAACTGAACCTCCAGAAGGG - Intronic
1046671316 8:117059642-117059664 GTCCAACTAAACCAACATGATGG - Intronic
1048706150 8:137155785-137155807 GGAGAACTCAACCACCAGAAGGG - Intergenic
1049425131 8:142534617-142534639 GTACCAGTCAACCACCAGCCGGG + Intronic
1049772707 8:144391126-144391148 GAACAACTCATCCACCTGGAAGG - Exonic
1050278985 9:4030952-4030974 AAATAACACAACCACCAGGATGG + Intronic
1052990008 9:34513565-34513587 GTACATCCCAGCCAGCAGGATGG + Intronic
1055012198 9:71579199-71579221 CCCCAACTCAACCTCCAGGAAGG - Intergenic
1056720407 9:89066326-89066348 TTATATCTCATCCACCAGGAAGG - Intronic
1058012720 9:99996213-99996235 CTAGAACTCAACTACCATGAGGG - Intronic
1058953320 9:109923645-109923667 GTACAAATCGCCCAACAGGAAGG + Intronic
1059842300 9:118231169-118231191 GTACCAATCAACCTCTAGGATGG - Intergenic
1062687476 9:137822108-137822130 GTGGAACTCATCCACCAGGATGG - Intronic
1188599064 X:31939261-31939283 GTACAACTCAAGCACCAACCAGG - Intronic
1190339787 X:49287044-49287066 GCACAGCGCAAGCACCAGGAGGG - Exonic
1199843944 X:151677195-151677217 TTACAAGTCAAGCACCAAGAAGG + Intergenic
1201755233 Y:17480004-17480026 GGACTACTCAACTTCCAGGATGG + Intergenic
1201846319 Y:18425981-18426003 GGACTACTCAACTTCCAGGATGG - Intergenic