ID: 1039465351

View in Genome Browser
Species Human (GRCh38)
Location 8:37781519-37781541
Sequence CTCGCTTACCAATTCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039465349_1039465351 0 Left 1039465349 8:37781496-37781518 CCAAAGCTTTGAAGGAGGAAGTA No data
Right 1039465351 8:37781519-37781541 CTCGCTTACCAATTCCTGAAGGG No data
1039465347_1039465351 4 Left 1039465347 8:37781492-37781514 CCCACCAAAGCTTTGAAGGAGGA No data
Right 1039465351 8:37781519-37781541 CTCGCTTACCAATTCCTGAAGGG No data
1039465348_1039465351 3 Left 1039465348 8:37781493-37781515 CCACCAAAGCTTTGAAGGAGGAA No data
Right 1039465351 8:37781519-37781541 CTCGCTTACCAATTCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039465351 Original CRISPR CTCGCTTACCAATTCCTGAA GGG Intergenic
No off target data available for this crispr