ID: 1039467933

View in Genome Browser
Species Human (GRCh38)
Location 8:37797169-37797191
Sequence GAGTGCTCAGCGGGGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039467933_1039467941 -7 Left 1039467933 8:37797169-37797191 CCCCGGGCCCCCGCTGAGCACTC 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1039467941 8:37797185-37797207 AGCACTCCTCCCGCACGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1039467933_1039467940 -8 Left 1039467933 8:37797169-37797191 CCCCGGGCCCCCGCTGAGCACTC 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1039467940 8:37797184-37797206 GAGCACTCCTCCCGCACGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 88
1039467933_1039467950 18 Left 1039467933 8:37797169-37797191 CCCCGGGCCCCCGCTGAGCACTC 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1039467950 8:37797210-37797232 CCTCCGGCCGGCGCGCAGCCCGG 0: 1
1: 0
2: 1
3: 32
4: 176
1039467933_1039467944 2 Left 1039467933 8:37797169-37797191 CCCCGGGCCCCCGCTGAGCACTC 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1039467944 8:37797194-37797216 CCCGCACGCCTGGGTCCCTCCGG 0: 1
1: 0
2: 2
3: 17
4: 143
1039467933_1039467946 6 Left 1039467933 8:37797169-37797191 CCCCGGGCCCCCGCTGAGCACTC 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1039467946 8:37797198-37797220 CACGCCTGGGTCCCTCCGGCCGG 0: 1
1: 0
2: 0
3: 24
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039467933 Original CRISPR GAGTGCTCAGCGGGGGCCCG GGG (reversed) Intronic
900102554 1:968055-968077 GAGTCCTCCCCGGGGCCCCGAGG + Intronic
900105604 1:979576-979598 GAGCCCTCAGCAGGGGCCCCCGG - Exonic
900230450 1:1554402-1554424 GGGTGGTCAGCGAGGGCTCGTGG - Intronic
901054149 1:6440804-6440826 TAGAGGTCAGCGCGGGCCCGGGG + Exonic
902480161 1:16707527-16707549 TAGAGGTCAGCGCGGGCCCGGGG - Intergenic
903360255 1:22772470-22772492 GAGGGCTGAGCAGGGGGCCGAGG + Intronic
903501196 1:23800904-23800926 GACTGCGCAGCGCGCGCCCGCGG + Intergenic
904620636 1:31772975-31772997 GAGTGCCCATCGAGTGCCCGTGG - Intergenic
904822291 1:33253615-33253637 GAGTGCTGAGCTGGGGCCTTTGG - Intergenic
905847058 1:41242061-41242083 GAGGGCGCGGCGGGGGCGCGGGG + Intronic
909366511 1:74829678-74829700 GAGTGTTTAGAGGGGTCCCGTGG - Intergenic
913760351 1:122125732-122125754 GAATGCTCGGCCGGGCCCCGTGG - Intergenic
917968639 1:180193866-180193888 GAGAGGTCAGCAGGGGCCAGAGG - Intronic
922758472 1:228109584-228109606 GAGTGCTGAGGGAGGACCCGGGG + Intergenic
1064354400 10:14604313-14604335 GACTGCTCGGCGGCGGCCCGAGG + Intronic
1067681390 10:48443649-48443671 GAGGGCTCTGCAGGGGCCTGGGG + Intergenic
1069755968 10:70774617-70774639 GACTTCCCAGCGTGGGCCCGGGG - Intronic
1069868153 10:71516891-71516913 GAGTGCTCAGCCCGGGTCCCAGG + Intronic
1073845224 10:107546041-107546063 GAGTGGGCAGCAGGGGCCAGTGG + Intergenic
1074038158 10:109761720-109761742 CAGTGCTCAGTGTGGGCCTGTGG - Intergenic
1074721610 10:116270568-116270590 GAGAGGTCAGCGGGGTCCCGGGG + Intronic
1075421128 10:122301509-122301531 GAGTGGTCAGCGTGGGCACATGG - Intronic
1076841387 10:133047583-133047605 CAGTGGGCAGTGGGGGCCCGAGG - Intergenic
1076887320 10:133268660-133268682 GAGTGCCCAGCACGGGCCCATGG - Intronic
1077042017 11:529036-529058 GAGTGCTCAGGGATGGCCCTTGG - Intergenic
1077200182 11:1302859-1302881 GAGTGCTCAGCGAGGGCTCCTGG - Intronic
1077298082 11:1835290-1835312 GAGAGCCCAGCGGGGCCCTGGGG - Exonic
1078108067 11:8371054-8371076 AAGTGCTCAGTGGGGGCCTGGGG + Intergenic
1078515602 11:12019480-12019502 GTGTGCTCAGCTGGGGCTCATGG + Intergenic
1081353978 11:42090711-42090733 GAGTGCTCACTGGGGGCCACAGG - Intergenic
1081806737 11:45895012-45895034 CAGTGCTCAGAGGGAGCACGTGG - Intronic
1081811024 11:45914184-45914206 CAGTGCTCAGCCTGGGCCTGTGG - Exonic
1082833980 11:57638982-57639004 GAGTGTTCCGAGGGGGACCGGGG + Intergenic
1083291866 11:61695027-61695049 GAGTACACAGAGAGGGCCCGTGG - Intronic
1084040457 11:66539619-66539641 GAGGGCCCAGCGGGGCCCCAGGG + Exonic
1084751214 11:71205397-71205419 GAGCGCCCAGCAGGGGCACGAGG - Intronic
1092936117 12:13366195-13366217 GGGGCCTCAGCGGGAGCCCGCGG - Intergenic
1092940832 12:13405549-13405571 GAGTGCTCAGCGTGAGTCGGTGG + Intergenic
1097264677 12:57738343-57738365 GGGGGCTCAGCGGGGTCCGGGGG - Intronic
1097990234 12:65825534-65825556 GAGTGCGCCGCGCGGCCCCGGGG + Intronic
1101554087 12:105790870-105790892 GAGTAGTCAGCGGAGGCCCATGG + Intergenic
1102877451 12:116459067-116459089 CAGGGCTAAGCGGGGGCCCCAGG - Intergenic
1104608800 12:130210931-130210953 AAGTCCACAGCGGCGGCCCGGGG + Intergenic
1108126384 13:47248855-47248877 GACTGCTCAGCTGGGCCCAGGGG - Intergenic
1108928060 13:55777814-55777836 GAATGCTCTTCAGGGGCCCGGGG + Intergenic
1112050966 13:95643902-95643924 CAGATCTCAGCGGGGGCGCGCGG - Intronic
1113812800 13:113152559-113152581 CAGCGCTCAGCGGGGGCGAGGGG + Intergenic
1122292576 14:100687558-100687580 GAGGGCGAGGCGGGGGCCCGTGG + Intergenic
1122352579 14:101104556-101104578 GTGGGCTCTGTGGGGGCCCGGGG - Intergenic
1122924066 14:104891788-104891810 GAGTGCTGGGCGGGGGCCTGAGG + Intronic
1123054466 14:105562460-105562482 GAGAGGTCAGCAGGGGCCCAAGG + Intergenic
1123079050 14:105682879-105682901 GAGAGGTCAGCAGGGGCCCAAGG + Intergenic
1124142282 15:27088238-27088260 GAGTGCTCGGGGCGGGCGCGGGG + Intronic
1124340990 15:28889003-28889025 GTGTGCCCAGCGGGGGCTGGGGG + Intronic
1125577902 15:40767623-40767645 GAGTGCCCAGCTCCGGCCCGGGG - Exonic
1127011170 15:54630708-54630730 GAGTGATCAGTGGAGGCCTGGGG - Exonic
1128683611 15:69668232-69668254 GGGTGCACAGCAGGGGCCCCAGG + Intergenic
1128905900 15:71467264-71467286 GAGTGCTCAGCCGTGAACCGAGG - Intronic
1132904892 16:2277564-2277586 GAGTGCCCAGTGGGGCCCCAGGG + Intronic
1136365280 16:29806656-29806678 CGGGGCTCAGCGGGGGCCGGGGG - Exonic
1138512904 16:57518824-57518846 GAGTGCTCAGCGTGGAGCCAAGG + Intronic
1139923438 16:70473322-70473344 GCGTGGCCAGCAGGGGCCCGGGG - Exonic
1142713973 17:1738059-1738081 GAGTGCCCAGCGGGGGCTGAGGG - Exonic
1146946250 17:36875687-36875709 CCGTGCTCAGCTGGGGGCCGAGG - Intergenic
1148215308 17:45830833-45830855 GAGCCCTCAGCGGGGGCTGGAGG - Intronic
1148337440 17:46851365-46851387 GAGCGCTCACCTGGGGCCGGAGG + Intronic
1150389000 17:64780318-64780340 GAGTGCGCTGCGGGGTCCGGGGG - Intergenic
1152403364 17:80082767-80082789 AGGGGCTCGGCGGGGGCCCGGGG - Intronic
1152432983 17:80260135-80260157 GAGCGCTCCGCGCGGGGCCGCGG + Intergenic
1157136714 18:45063576-45063598 GGGGGCTGAGCGGGGGCCTGCGG - Exonic
1161339676 19:3734391-3734413 GCATGCTCAGCGGAGCCCCGAGG + Exonic
1162572452 19:11481016-11481038 GAGCGCGCAGCGCGGGCCGGAGG - Exonic
1163731052 19:18949330-18949352 GAGTGCACAGCAGGGGCTCTGGG + Intergenic
1165406449 19:35633923-35633945 GAATGCGCAGCGGGGGCAGGAGG - Exonic
1166688784 19:44810770-44810792 GAGTGTTCAGCGGAGGCCACAGG + Intronic
1166894451 19:46015258-46015280 AGGTGAGCAGCGGGGGCCCGGGG + Exonic
1167601727 19:50458874-50458896 GGGGGCTCAGCGGGGGGCCGGGG - Intronic
1168414509 19:56159922-56159944 GAGGGCGCAGCGCGGGCCCGGGG - Exonic
1202714198 1_KI270714v1_random:33433-33455 TAGGGGTCAGCGCGGGCCCGGGG - Intergenic
925215907 2:2095775-2095797 GAGCGGTCAGGGGGTGCCCGGGG - Intronic
926111924 2:10189095-10189117 GAGGGCTAAGCGAGGGCCCATGG + Intronic
926233596 2:11023089-11023111 GACTGCTCAGCAGGTGCCCAGGG + Intergenic
927423079 2:22953303-22953325 GAGAGGTCAGCAGGGGCCCGGGG - Intergenic
927491911 2:23526433-23526455 GAGGGCTCTGCAGGGGCCGGGGG + Intronic
927684453 2:25161060-25161082 GAGGGCACAGCGGGGCCCCAGGG - Exonic
932126560 2:69150162-69150184 GAGTGCTCAGCAGGGGCTGCTGG - Intronic
934714963 2:96537895-96537917 GAGTGCTCCGCGGGCCCCAGGGG + Intronic
936064362 2:109319378-109319400 GTGGGCTCAGTGGGGTCCCGGGG + Intronic
937983790 2:127629596-127629618 GAGGGCTCTGCAGGGGCCAGAGG - Intronic
938051083 2:128172332-128172354 GAGTGCTCAGTGGTGGCCTGTGG - Intronic
939992395 2:148887987-148888009 CGGTGCTCAGCGGGGACCCGCGG - Intronic
943725151 2:191245389-191245411 GAGTGCTCAGCGGCGGCGGGAGG - Exonic
946397304 2:219449337-219449359 GACTGCTCAGCAGGAGCCGGGGG + Intronic
946419711 2:219557923-219557945 GAGGACTCGGCGGGGGCCCTCGG + Exonic
948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG + Intronic
948809888 2:240469044-240469066 GGGGGCTCAGCGGGGCCCCTAGG + Intergenic
1168914707 20:1476352-1476374 GAGAGCTCAGGCGGGACCCGTGG + Intronic
1169145335 20:3248622-3248644 GCGCGGCCAGCGGGGGCCCGGGG + Intergenic
1171977596 20:31605422-31605444 CAGCGCGCAGCTGGGGCCCGCGG - Exonic
1172623674 20:36335479-36335501 GAGTGTTCAGCCTGGGCCAGGGG - Intronic
1173498567 20:43536042-43536064 GAGGGCTCAGCGGGGACCAGTGG + Intronic
1173811321 20:45957600-45957622 GAGTGCTCAGCGGGAACTGGGGG - Exonic
1175289896 20:57868635-57868657 GTTTGCTCATCTGGGGCCCGTGG + Intergenic
1175610140 20:60344283-60344305 GAGAGCTGAGTGGGGGCCCAAGG + Intergenic
1175892211 20:62320942-62320964 GAATGATCAGCTGGGGCCCTGGG + Intronic
1175920023 20:62446330-62446352 GAGGGCAGGGCGGGGGCCCGGGG + Intergenic
1176194697 20:63831615-63831637 AAGGGCGCAGCGGGGGCCAGGGG - Intergenic
1179621281 21:42617782-42617804 GCGTGCTCAGCAGAGGCGCGGGG - Intergenic
1181125498 22:20699646-20699668 GAGTTCTCATCGGAAGCCCGGGG + Intergenic
1181280499 22:21716472-21716494 GAGTTCTCATCGGAAGCCCGGGG - Intronic
1181870032 22:25890878-25890900 GAGTGGTCAGGGGTGGCCAGGGG + Intronic
1181977392 22:26740580-26740602 GAGAGTTCAGCGGGGCCCCTGGG - Intergenic
1183647520 22:39134962-39134984 GAGTGCTCTGTGGGGCCCAGAGG - Intronic
1184445301 22:44543755-44543777 GGGTGCTCGGCGGGGGCGGGCGG + Intergenic
1184528063 22:45037151-45037173 GAGCTCTCAGCGGGGACCCAGGG + Intergenic
1185331553 22:50254270-50254292 GACTGCTTAGCGGGGGCTGGGGG + Intronic
950345404 3:12288073-12288095 GAGTGCTCAGGGAGGGGGCGCGG + Intronic
952912687 3:38204154-38204176 CAGTGTTCAGCTGGGGCCCAAGG + Intronic
954327143 3:49869793-49869815 GCGGGCTCAGCGGGGCGCCGAGG + Exonic
961868963 3:129974713-129974735 GAGGGCTCGGCAGGCGCCCGGGG + Exonic
962331962 3:134486181-134486203 GCGTGCGCAGCGCCGGCCCGAGG + Intronic
962998404 3:140653311-140653333 CAGTGCTCACCGTGGGCCTGTGG + Intergenic
967880357 3:194297255-194297277 GTGGGCGCAGCGGGGGCCCGGGG - Intergenic
967889001 3:194351658-194351680 GAGAGCCCAGCAGGGGCCTGAGG - Intergenic
976068350 4:81215085-81215107 CGGTGCGCAGCGTGGGCCCGGGG + Exonic
980729965 4:136812214-136812236 CAGTGCTCAGTGGCGGCCTGGGG + Intergenic
991254409 5:64598611-64598633 GAATGCTCTGAGGGGGCCCAAGG + Intronic
993904086 5:93604200-93604222 AAGGGCTCCGCGGGGGCACGGGG + Intergenic
997265171 5:132490990-132491012 GAGCGCTCGGGGCGGGCCCGCGG - Intergenic
1001392075 5:171387653-171387675 GCGTGCTCGGTGGGAGCCCGCGG + Exonic
1002524204 5:179806590-179806612 GGGTGCGCGGCGGGCGCCCGCGG + Intronic
1002927811 6:1614874-1614896 GAGAGCTCGGCGGGGCCCTGCGG - Intergenic
1006034798 6:31202757-31202779 GAGTGCTCAGAGGGTGACTGAGG - Exonic
1006441700 6:34057350-34057372 GAAAGCTCAGCGGGGCCACGTGG + Intronic
1011640407 6:89412097-89412119 TAGAGCTCAGCGGGGCCCGGCGG + Exonic
1018376813 6:163220384-163220406 GACTGCTAAGCGGGGGCAAGTGG + Intronic
1018896141 6:168018878-168018900 CAGTGCTCAGCGGAGGCTTGAGG - Intronic
1019189745 6:170244940-170244962 GAGAGCTCAGGGAGGCCCCGGGG + Intergenic
1023621968 7:42082538-42082560 AAGTCCTCAGCGGGGCCCTGTGG - Intronic
1032705488 7:134418057-134418079 GAGGGCTTAGCTGGGGCCCCTGG + Intergenic
1035019764 7:155794004-155794026 GTGTGCCCAGCCAGGGCCCGGGG + Intergenic
1035169736 7:157010714-157010736 GCGCGCGCAGCGGGGGCCCGGGG + Intergenic
1035675771 8:1454794-1454816 GAGTGCTCAGTGGGGGTCTCTGG - Intergenic
1036044597 8:5125458-5125480 GAGTGCTCAGCTGGGGCATGTGG - Intergenic
1036398064 8:8385801-8385823 GAGGGCTCAGCCAGGGCTCGGGG + Intronic
1037907683 8:22725046-22725068 GAGTGCTGATCTGGGGCCCCAGG - Intronic
1039467933 8:37797169-37797191 GAGTGCTCAGCGGGGGCCCGGGG - Intronic
1056826628 9:89880375-89880397 GTGTGGTCAGCGGGGCACCGTGG + Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061839147 9:133347694-133347716 CGGTGCTCAGGGAGGGCCCGGGG + Exonic
1062500545 9:136850214-136850236 GCGTGCTCAGCTGGGGCCACGGG - Intronic
1062531530 9:137003090-137003112 GACGGCTCAGAGGGGCCCCGGGG + Intergenic
1186608997 X:11120332-11120354 GAGTCCTCAGCAGGGGTCTGCGG + Intronic
1188860016 X:35244732-35244754 TGGTGCTCAGGGGTGGCCCGGGG + Intergenic
1190380048 X:49830074-49830096 GAGTTCTCAGTGGGGACCTGGGG + Intronic
1195287144 X:103396404-103396426 GAGTGCCCTGCTGGGGCCGGGGG + Intergenic
1196834053 X:119798615-119798637 GAGTGCTGAGTGGGGGCCAGGGG - Intergenic
1197555476 X:127947333-127947355 GAATGCTCAGGTGGGGCCAGTGG + Intergenic
1197806338 X:130402008-130402030 GAGTGCTGAGCGCGAACCCGAGG + Exonic
1198727460 X:139692242-139692264 GAGTGCCCAGCGGCGGCGCGCGG - Intronic
1200215628 X:154366999-154367021 GAGAGCACAGCTGGGTCCCGAGG - Intronic