ID: 1039468196

View in Genome Browser
Species Human (GRCh38)
Location 8:37798056-37798078
Sequence GCTTCCAGCCGGTCTCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039468190_1039468196 -6 Left 1039468190 8:37798039-37798061 CCTGGCCTGCCAGCGCCGCTTCC 0: 1
1: 0
2: 3
3: 34
4: 381
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data
1039468188_1039468196 -4 Left 1039468188 8:37798037-37798059 CCCCTGGCCTGCCAGCGCCGCTT 0: 1
1: 0
2: 2
3: 8
4: 167
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data
1039468181_1039468196 25 Left 1039468181 8:37798008-37798030 CCCTTCAATTGGGGTCATCCCAT 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data
1039468189_1039468196 -5 Left 1039468189 8:37798038-37798060 CCCTGGCCTGCCAGCGCCGCTTC 0: 1
1: 1
2: 2
3: 11
4: 195
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data
1039468186_1039468196 2 Left 1039468186 8:37798031-37798053 CCTTGCCCCCTGGCCTGCCAGCG 0: 1
1: 0
2: 3
3: 31
4: 438
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data
1039468187_1039468196 -3 Left 1039468187 8:37798036-37798058 CCCCCTGGCCTGCCAGCGCCGCT 0: 1
1: 0
2: 1
3: 43
4: 568
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data
1039468182_1039468196 24 Left 1039468182 8:37798009-37798031 CCTTCAATTGGGGTCATCCCATC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data
1039468185_1039468196 6 Left 1039468185 8:37798027-37798049 CCATCCTTGCCCCCTGGCCTGCC 0: 1
1: 2
2: 12
3: 81
4: 959
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data
1039468184_1039468196 7 Left 1039468184 8:37798026-37798048 CCCATCCTTGCCCCCTGGCCTGC 0: 1
1: 0
2: 4
3: 35
4: 426
Right 1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039468196 Original CRISPR GCTTCCAGCCGGTCTCCTTA GGG Intronic
No off target data available for this crispr