ID: 1039468839

View in Genome Browser
Species Human (GRCh38)
Location 8:37801419-37801441
Sequence AGGGAGAACCTGGGTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039468820_1039468839 18 Left 1039468820 8:37801378-37801400 CCTCCCCCAGGGAAAAGGTCCCA 0: 1
1: 0
2: 0
3: 13
4: 208
Right 1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG No data
1039468821_1039468839 15 Left 1039468821 8:37801381-37801403 CCCCCAGGGAAAAGGTCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG No data
1039468825_1039468839 13 Left 1039468825 8:37801383-37801405 CCCAGGGAAAAGGTCCCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG No data
1039468827_1039468839 12 Left 1039468827 8:37801384-37801406 CCAGGGAAAAGGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 18
4: 92
Right 1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG No data
1039468831_1039468839 -1 Left 1039468831 8:37801397-37801419 CCCACGGGGGGTGGCTTATGACA 0: 1
1: 0
2: 0
3: 5
4: 28
Right 1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG No data
1039468832_1039468839 -2 Left 1039468832 8:37801398-37801420 CCACGGGGGGTGGCTTATGACAG 0: 1
1: 0
2: 0
3: 8
4: 181
Right 1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG No data
1039468818_1039468839 28 Left 1039468818 8:37801368-37801390 CCTTTGTGGGCCTCCCCCAGGGA 0: 1
1: 0
2: 0
3: 18
4: 195
Right 1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG No data
1039468823_1039468839 14 Left 1039468823 8:37801382-37801404 CCCCAGGGAAAAGGTCCCACGGG 0: 1
1: 0
2: 2
3: 9
4: 117
Right 1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039468839 Original CRISPR AGGGAGAACCTGGGTGTGGG AGG Intronic
No off target data available for this crispr