ID: 1039469611

View in Genome Browser
Species Human (GRCh38)
Location 8:37805079-37805101
Sequence GATGCTATCTCCTAGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039469607_1039469611 -1 Left 1039469607 8:37805057-37805079 CCGGCTCACTCAGAGAAGGATGG 0: 1
1: 0
2: 4
3: 14
4: 198
Right 1039469611 8:37805079-37805101 GATGCTATCTCCTAGGTGTTGGG No data
1039469601_1039469611 23 Left 1039469601 8:37805033-37805055 CCCAGAAAGGCTGTACCGTGGAG 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1039469611 8:37805079-37805101 GATGCTATCTCCTAGGTGTTGGG No data
1039469604_1039469611 8 Left 1039469604 8:37805048-37805070 CCGTGGAGCCCGGCTCACTCAGA 0: 1
1: 0
2: 2
3: 14
4: 231
Right 1039469611 8:37805079-37805101 GATGCTATCTCCTAGGTGTTGGG No data
1039469602_1039469611 22 Left 1039469602 8:37805034-37805056 CCAGAAAGGCTGTACCGTGGAGC 0: 1
1: 0
2: 2
3: 6
4: 71
Right 1039469611 8:37805079-37805101 GATGCTATCTCCTAGGTGTTGGG No data
1039469606_1039469611 0 Left 1039469606 8:37805056-37805078 CCCGGCTCACTCAGAGAAGGATG 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1039469611 8:37805079-37805101 GATGCTATCTCCTAGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039469611 Original CRISPR GATGCTATCTCCTAGGTGTT GGG Intronic
No off target data available for this crispr