ID: 1039469960

View in Genome Browser
Species Human (GRCh38)
Location 8:37807231-37807253
Sequence AAGGGACATAAATGTTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 321}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039469960_1039469967 15 Left 1039469960 8:37807231-37807253 CCTCACCAACATTTATGTCCCTT 0: 1
1: 0
2: 1
3: 36
4: 321
Right 1039469967 8:37807269-37807291 GCATGTGAAGGCAGCCACGGAGG No data
1039469960_1039469966 12 Left 1039469960 8:37807231-37807253 CCTCACCAACATTTATGTCCCTT 0: 1
1: 0
2: 1
3: 36
4: 321
Right 1039469966 8:37807266-37807288 AATGCATGTGAAGGCAGCCACGG No data
1039469960_1039469969 20 Left 1039469960 8:37807231-37807253 CCTCACCAACATTTATGTCCCTT 0: 1
1: 0
2: 1
3: 36
4: 321
Right 1039469969 8:37807274-37807296 TGAAGGCAGCCACGGAGGGACGG No data
1039469960_1039469968 16 Left 1039469960 8:37807231-37807253 CCTCACCAACATTTATGTCCCTT 0: 1
1: 0
2: 1
3: 36
4: 321
Right 1039469968 8:37807270-37807292 CATGTGAAGGCAGCCACGGAGGG No data
1039469960_1039469970 21 Left 1039469960 8:37807231-37807253 CCTCACCAACATTTATGTCCCTT 0: 1
1: 0
2: 1
3: 36
4: 321
Right 1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG No data
1039469960_1039469965 3 Left 1039469960 8:37807231-37807253 CCTCACCAACATTTATGTCCCTT 0: 1
1: 0
2: 1
3: 36
4: 321
Right 1039469965 8:37807257-37807279 GTCAGGCTAAATGCATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039469960 Original CRISPR AAGGGACATAAATGTTGGTG AGG (reversed) Intronic
901030399 1:6304142-6304164 AAGGCCCAGAAATTTTGGTGGGG + Intronic
902794225 1:18790583-18790605 AAGCAACATAAATTTTGGGGTGG - Intergenic
904585544 1:31577751-31577773 AAGGCACATATGGGTTGGTGAGG + Intronic
906995372 1:50788024-50788046 CAGAGACAGAAATGTTGATGTGG - Exonic
908111025 1:60897450-60897472 AAGGGGCATAGATGATGGTGAGG - Intronic
908524352 1:64973392-64973414 AAGGAATATAAATATTGGGGAGG + Intergenic
908713662 1:67046883-67046905 AAGGGAAATGAATGTTGGAAGGG - Intronic
910151753 1:84156355-84156377 AAGGTACATAAAATTTGTTGGGG - Intronic
911028419 1:93459564-93459586 AGGAAAGATAAATGTTGGTGAGG + Intronic
911082331 1:93945569-93945591 AAAGAAAATAAGTGTTGGTGAGG - Intergenic
912148973 1:106832667-106832689 TTGGGACATAAATTTTGGTGTGG + Intergenic
913281957 1:117194362-117194384 AAGTGATAAAAATGTTGGTGCGG + Intronic
913720635 1:121589426-121589448 AAGGGACATAAAAGTAGGTAAGG + Intergenic
913975880 1:143454775-143454797 CAAAGACATAAGTGTTGGTGAGG + Intergenic
914070275 1:144280396-144280418 CAAAGACATAAGTGTTGGTGAGG + Intergenic
914108880 1:144685958-144685980 CAAAGACATAAGTGTTGGTGAGG - Intergenic
914940108 1:152014933-152014955 TTGGGACAGAAATGTAGGTGAGG + Intergenic
915358667 1:155272495-155272517 CAGGGACATAAGTCTTGGTGGGG + Intronic
915469392 1:156116423-156116445 AAGGGAAACAAATTTTGATGGGG - Intronic
915843928 1:159242006-159242028 AAGGATGATAAATGTTGATGAGG - Intergenic
918087471 1:181257910-181257932 AAGGGAGAGGATTGTTGGTGGGG - Intergenic
919193319 1:194251600-194251622 AAAGAAAACAAATGTTGGTGAGG + Intergenic
921145923 1:212356246-212356268 AAGGAAAATATAAGTTGGTGGGG - Intronic
921603207 1:217129327-217129349 AAGGAAAATAAATGTTGATGAGG + Intronic
922598156 1:226829635-226829657 AAAGAAAATAAGTGTTGGTGAGG + Intergenic
923000989 1:230006260-230006282 AAGGGACATGGATTATGGTGGGG - Intergenic
923400624 1:233613235-233613257 AAGTGACAAAAATGTGGGCGAGG - Intergenic
923440589 1:234016139-234016161 ATGAAACATAAGTGTTGGTGAGG + Intronic
924551091 1:245078180-245078202 AAAAGACAAAAGTGTTGGTGAGG + Intronic
1064681820 10:17817791-17817813 AATGTTTATAAATGTTGGTGTGG + Intronic
1067997723 10:51293877-51293899 AAAAGACAGAAATGTTGGTGAGG - Intronic
1068314839 10:55327000-55327022 ATGGATCATAAATGTTGCTGTGG + Intronic
1069011335 10:63376765-63376787 AATGAAAGTAAATGTTGGTGAGG + Intronic
1070226280 10:74510216-74510238 AAGAAAAAAAAATGTTGGTGAGG - Intronic
1070975734 10:80604285-80604307 AGGGGACACAAATGTGTGTGAGG - Intronic
1071022425 10:81073334-81073356 AGGGAAAATAAGTGTTGGTGAGG - Intergenic
1072111240 10:92322325-92322347 AAAGGACATAAATATTAGGGTGG - Intronic
1073759992 10:106618987-106619009 ATGGGAAATAAATGTTTGTGAGG - Intronic
1073999402 10:109354056-109354078 AACAAACATAAATGCTGGTGAGG - Intergenic
1074202061 10:111246253-111246275 CAGGGAAAAAAATGTTGCTGTGG + Intergenic
1075415608 10:122260445-122260467 ACAGAAAATAAATGTTGGTGAGG - Intergenic
1077608572 11:3628768-3628790 AGGGCACATAGATGTTGTTGAGG - Intergenic
1077806327 11:5594802-5594824 AAGGGACTTAAATGTTGGCTGGG + Intronic
1079278760 11:19068763-19068785 AAAGTAAATAAATGCTGGTGGGG - Intergenic
1081974783 11:47226259-47226281 AAAGAAAATAAATGTTGGTGGGG - Intronic
1083928794 11:65826961-65826983 TAAGAATATAAATGTTGGTGGGG - Intronic
1084266405 11:68007643-68007665 ATGGGACATAAGTGATTGTGAGG - Intergenic
1084836536 11:71805869-71805891 AAGGAACAGAAGTGTTGTTGTGG - Intergenic
1085377309 11:76076615-76076637 AAGAAAAATAAGTGTTGGTGAGG - Intronic
1087235163 11:95709990-95710012 ATGGGATATAAATGGTGGAGTGG - Intergenic
1087403542 11:97699239-97699261 AAGGAACAGAAATGTCTGTGGGG - Intergenic
1088454422 11:110018739-110018761 AAGTGACAGAAAGGTTGGTTTGG + Intergenic
1088578430 11:111295178-111295200 ATGGGAAATATATGTTGGTTGGG - Intergenic
1089501946 11:118937473-118937495 AAGGGACATCAAGCTGGGTGCGG - Intronic
1090940692 11:131385451-131385473 AAGGAAAATAAATATTGGTGAGG + Intronic
1091148667 11:133304725-133304747 AAGGGACACAAATGTTGCCATGG + Intronic
1093110421 12:15145242-15145264 AAGGGAGATAAATTTTGGTGTGG + Intronic
1093717057 12:22394599-22394621 AAGGAAAACAGATGTTGGTGAGG - Intronic
1094487070 12:30933752-30933774 AAGGGACAGCAGTGTTGTTGAGG + Intronic
1096709035 12:53442084-53442106 AAGGGAGATGAGTGATGGTGGGG + Intronic
1098295350 12:68998601-68998623 AAGGAAAATAAATAATGGTGGGG - Intergenic
1099554056 12:84087560-84087582 AACCAAAATAAATGTTGGTGAGG - Intergenic
1100587647 12:95994839-95994861 AAGGAACATATAGGGTGGTGTGG + Intronic
1101257571 12:102993639-102993661 AGGGGACATGAATATTGATGGGG + Intergenic
1103276322 12:119714672-119714694 AAGGAAGATAAGTGTTGATGAGG + Intronic
1105223358 13:18354959-18354981 CAAAGACATAAGTGTTGGTGAGG - Intergenic
1105930358 13:25046917-25046939 AAGGGACAGAGCTGTCGGTGCGG - Intergenic
1114062756 14:19035363-19035385 ATGGAAGATAAGTGTTGGTGAGG - Intergenic
1114099503 14:19364634-19364656 ATGGAAGATAAGTGTTGGTGAGG + Intergenic
1114306719 14:21430259-21430281 AAGGGCCAAAAGAGTTGGTGGGG - Intronic
1116525800 14:45903596-45903618 TAGGGACATTAGTGTTGGGGTGG - Intergenic
1116682880 14:47997308-47997330 AAGCTACATAAATGTTAATGAGG - Intergenic
1117050490 14:51855003-51855025 AACAAACATAAATGTTGATGAGG - Intronic
1117722919 14:58645333-58645355 AAGGGAATTAAATTGTGGTGTGG - Exonic
1118080358 14:62351595-62351617 AAAGGTAATAATTGTTGGTGAGG - Intergenic
1118462627 14:66000740-66000762 AAGGGACAGAAATGGGAGTGAGG + Intronic
1119350020 14:73956506-73956528 AAGGAAAATAAGCGTTGGTGAGG - Intronic
1119692281 14:76684332-76684354 AAGGATAACAAATGTTGGTGAGG - Intergenic
1124124167 15:26923002-26923024 AAGGGACATAAAGGGAGGTAAGG - Intronic
1124378867 15:29147642-29147664 AAAGATCATAAATGTTGGAGTGG + Intronic
1124684428 15:31768748-31768770 AAGGGACCTATATGGTGGTAAGG + Intronic
1125582922 15:40799820-40799842 GAGAGAAATAAATGTTGGTCAGG - Intronic
1126075938 15:44909523-44909545 AAGACAGATAAATGTTGTTGAGG + Intergenic
1129565165 15:76614094-76614116 CAGGGACATGAATGGTGCTGCGG + Intronic
1129632341 15:77274656-77274678 AAAAAACATAGATGTTGGTGTGG + Intronic
1129890881 15:79071101-79071123 AAGGGAGATGAATGTTGGCTTGG + Intronic
1129900810 15:79147984-79148006 AAAAAACACAAATGTTGGTGAGG - Intergenic
1130570566 15:85039442-85039464 ATGGAAAATAAACGTTGGTGAGG + Intronic
1130694531 15:86117306-86117328 AAGGGAAAAAAAAGTTGGTCAGG - Intergenic
1131108284 15:89749254-89749276 TAGAGACATAAATAATGGTGTGG - Exonic
1131270751 15:90946367-90946389 AAGGGACATCACTGGTGGTATGG + Intronic
1131313287 15:91310136-91310158 AAGAGAACTAAATGTTGGGGAGG - Intergenic
1131437114 15:92431930-92431952 GAGAGAGATAAATGCTGGTGTGG - Intronic
1132282675 15:100633710-100633732 AAGAGAAATAAATGGTAGTGAGG + Intronic
1134208393 16:12256024-12256046 AAGAAAGATAAATGTTGGTGAGG - Intronic
1135821412 16:25689939-25689961 AAGTGACATAAATGTGTGGGGGG + Intergenic
1137065637 16:35840025-35840047 AAGACAGATAAATGTGGGTGAGG + Intergenic
1137422630 16:48348819-48348841 AAGGGAAAAAAATATTAGTGTGG + Intronic
1137484704 16:48881579-48881601 AAGTGACATAAAAGTGGCTGTGG - Intergenic
1137790176 16:51168364-51168386 TAGGGACATTAATGTTACTGTGG - Intergenic
1140496192 16:75390889-75390911 CAGGGATACAAATATTGGTGTGG - Intronic
1140678827 16:77363831-77363853 AAGTGACATAAACGTGGTTGTGG - Exonic
1140820175 16:78656289-78656311 AAAGGACATGCATGTTGGAGTGG - Intronic
1141196228 16:81863712-81863734 AAAGGAAGTAAGTGTTGGTGAGG - Intronic
1141226403 16:82120110-82120132 AAGGGATATCCATGTTGGTGAGG + Intergenic
1141598132 16:85109899-85109921 AAGGAACAGAAATCCTGGTGGGG - Intronic
1143351843 17:6294423-6294445 AAAGGAAACACATGTTGGTGAGG + Intergenic
1144612270 17:16731611-16731633 AAGGGACATATATATTTGAGAGG - Intronic
1144900461 17:18583690-18583712 AAGGGACATATATATTTGAGAGG + Intergenic
1145131986 17:20361995-20362017 AAGGGACATATATATTTGAGAGG - Intergenic
1146036968 17:29415493-29415515 ACGGGAAATAATTGTTGGAGAGG - Intronic
1146435036 17:32837035-32837057 AAAGGAAAAAAATATTGGTGAGG - Intronic
1147999980 17:44382050-44382072 AAGGGAAAAGAAAGTTGGTGTGG - Intronic
1148378816 17:47176668-47176690 AAGGAACATAAATTTGGGAGGGG + Intronic
1149285991 17:55165282-55165304 AAAGAACAAAAATGTTGGTAGGG + Intergenic
1150821620 17:68438981-68439003 AAGACAGATAAATGTTGGTGAGG + Intronic
1151497521 17:74467417-74467439 AGGGGACAGAAAAGGTGGTGGGG + Intronic
1152313355 17:79564516-79564538 AAGGAATATAAATGTTCTTGAGG - Intergenic
1152342471 17:79732866-79732888 AAGGGGCAGAAAGGCTGGTGTGG - Intronic
1153924156 18:9818793-9818815 ACAGGCAATAAATGTTGGTGAGG - Intronic
1154308610 18:13249395-13249417 ACAAGAAATAAATGTTGGTGTGG - Intronic
1155080402 18:22404495-22404517 AAAGGCAATAAGTGTTGGTGAGG - Intergenic
1155802045 18:30117871-30117893 AAGGGACCTAAATGGATGTGAGG + Intergenic
1156082927 18:33361793-33361815 ACAAGAGATAAATGTTGGTGAGG + Intronic
1156423361 18:36980349-36980371 AAGGGACAGATATACTGGTGGGG + Intronic
1157825907 18:50812156-50812178 ATGGAAAATAAATGTTGGTAAGG - Intronic
1162217862 19:9151044-9151066 AATTGGCATTAATGTTGGTGGGG + Intronic
1164901339 19:31928010-31928032 AAAACAAATAAATGTTGGTGCGG + Intergenic
1165902203 19:39174198-39174220 CAGGGACAGAGATGTGGGTGAGG - Intronic
1165924489 19:39318782-39318804 CATGGACACACATGTTGGTGTGG - Intergenic
1166349686 19:42190217-42190239 AAGTGAAATAAATATGGGTGTGG + Intronic
1167808129 19:51804094-51804116 AAGGGTGATTAATGTTGGTTAGG - Intronic
1168410136 19:56134675-56134697 GTGGGCCATAAATCTTGGTGAGG - Intronic
1168559822 19:57373439-57373461 AAGGGACATAAAATTGGGTGGGG - Intronic
928049365 2:27973445-27973467 TAGGGACAGAAGAGTTGGTGGGG - Intronic
930562978 2:52983745-52983767 AAAGGACACAAAGGTTGGAGTGG + Intergenic
931430978 2:62208883-62208905 AAGTCAGATAAATGTGGGTGAGG + Intronic
931598890 2:63982338-63982360 AGGTGACATAAATGTTGCTGTGG + Intronic
931846140 2:66206073-66206095 AAGGAAGATATATTTTGGTGAGG - Intergenic
932979429 2:76646530-76646552 AAGGAAAATAAGTGTTGGTGGGG + Intergenic
934180577 2:89615755-89615777 CAAAGACATAAGTGTTGGTGAGG + Intergenic
934290878 2:91690015-91690037 CAAAGACATAAGTGTTGGTGAGG + Intergenic
934975765 2:98801077-98801099 AAAGGAGAGAAATGGTGGTGTGG - Intronic
935004189 2:99054846-99054868 ACGAAAGATAAATGTTGGTGAGG + Intronic
936614684 2:114036221-114036243 AACGAAAATAGATGTTGGTGTGG - Intergenic
937890419 2:126934263-126934285 AAGAGACATATAAGTTGGAGTGG + Intergenic
938090671 2:128432027-128432049 AAAGGACCTAAATGTAAGTGAGG - Intergenic
938195984 2:129328732-129328754 ACAGAACATAAGTGTTGGTGAGG + Intergenic
939449276 2:142351961-142351983 ACAGGAAATAAGTGTTGGTGAGG + Intergenic
940014392 2:149088098-149088120 AGGGGACATAAAGTTGGGTGGGG - Intronic
940683715 2:156819648-156819670 CAGGCACATAAATGTTTGTTTGG - Intergenic
941478951 2:165982548-165982570 AAAAGCAATAAATGTTGGTGAGG - Intergenic
942956755 2:181782560-181782582 AAGTGACATAAATTTTGGGAAGG - Intergenic
943075804 2:183193054-183193076 AACGGACATAAATGTTCATTAGG - Intergenic
944400434 2:199319896-199319918 AAGGGAGAGAAATGTGGCTGAGG + Intronic
944906932 2:204271098-204271120 ATGGTACATGAATGTTGCTGTGG - Intergenic
945050979 2:205824184-205824206 AAAGAAAATAAGTGTTGGTGAGG + Intergenic
945118154 2:206429827-206429849 AAGAGACATAGAGGATGGTGAGG + Intergenic
945118703 2:206436509-206436531 ACAAGAGATAAATGTTGGTGAGG + Intergenic
946059019 2:216925931-216925953 AATGGACATGAATTTTGGTGGGG + Intergenic
946357682 2:219198760-219198782 TAAAGACATAAATGGTGGTGAGG - Intronic
946591434 2:221253250-221253272 AAAGGGCATAAATGTGGGTGAGG + Intergenic
948563621 2:238869955-238869977 ACAGAAAATAAATGTTGGTGAGG + Intronic
1173654167 20:44688184-44688206 AATGAAAATAAGTGTTGGTGAGG + Intergenic
1175005528 20:55678328-55678350 AAGGGACACAAATGAGGGGGAGG - Intergenic
1176731907 21:10507393-10507415 CAAAGACATAAGTGTTGGTGAGG - Intergenic
1177142435 21:17371403-17371425 AAGGGAGTTAAATTTTGGAGAGG - Intergenic
1177306917 21:19330692-19330714 AAAAGACAGAAATGGTGGTGGGG - Intergenic
1178140968 21:29683122-29683144 AAAAGACACAGATGTTGGTGAGG + Intronic
1178918664 21:36723889-36723911 AGGGGACAAAAGTGTTGGCGGGG - Intronic
1179179918 21:39036263-39036285 CATGGACATGAATGTTGGGGAGG - Intergenic
1179260388 21:39752656-39752678 CAAAGCCATAAATGTTGGTGTGG - Intronic
1180058387 21:45371829-45371851 CAGGGAGATAAATGAGGGTGAGG - Intergenic
1180481249 22:15757990-15758012 ATGGAAGATAAGTGTTGGTGAGG - Intergenic
1184053220 22:42024478-42024500 AAGGAAGATAAGTGTTGCTGAGG - Intronic
1184812244 22:46843980-46844002 AAGGCAGATAGATGTTTGTGGGG + Intronic
1184968143 22:47996281-47996303 AAGGCACATAAATTGTGTTGAGG - Intergenic
951455600 3:22888856-22888878 CAGAGACATATATGGTGGTGAGG - Intergenic
952446124 3:33382736-33382758 ATGGAAAATAAGTGTTGGTGAGG - Intronic
952690817 3:36203214-36203236 AGGGGATATAAATGTGGCTGAGG + Intergenic
952921569 3:38288572-38288594 AAAGGAAACAAATATTGGTGAGG - Intronic
953031770 3:39184421-39184443 GATGGAGATAAATGTTGGGGAGG + Exonic
953415862 3:42716678-42716700 AAGGAAAATAAGTGTTGGTGAGG + Intronic
954308010 3:49741302-49741324 AAGGGAAATAACTGTTGGCAAGG - Intronic
954785259 3:53087865-53087887 AAAGGAAATAAATCTTGATGGGG + Intronic
955359596 3:58261693-58261715 ATGGAAAATAAGTGTTGGTGAGG + Intronic
956772937 3:72541850-72541872 ACATGACATAGATGTTGGTGTGG - Intergenic
958111417 3:89151394-89151416 AAGGGACATAAGTAGGGGTGTGG + Intronic
960329135 3:116336633-116336655 GAGAAAAATAAATGTTGGTGAGG + Intronic
962446363 3:135469474-135469496 AAGGGGCAGAGATGTGGGTGAGG - Intergenic
964065170 3:152569088-152569110 AAGTGAAATAAATATGGGTGTGG + Intergenic
964714508 3:159707885-159707907 AAGGGACAGAAACCTTGGTCAGG - Intronic
965018175 3:163188203-163188225 CAGGGACGTATATGTTGGGGTGG + Intergenic
965136124 3:164771140-164771162 ATGAAAGATAAATGTTGGTGAGG - Intergenic
965454499 3:168881210-168881232 AAAGGAAATAAATTTTGCTGAGG + Intergenic
966091622 3:176145120-176145142 ATGGGACATAACTGTCAGTGAGG + Intergenic
966321579 3:178706767-178706789 AAGGCACAGAAACATTGGTGTGG - Intronic
966696691 3:182796679-182796701 CAGGGATACAAATGTTGGTCAGG + Intronic
966980637 3:185131108-185131130 AAGAAAGATAAGTGTTGGTGAGG - Intronic
967509400 3:190292109-190292131 AAGGGAAATAAATGTGGGGTTGG - Intergenic
968045740 3:195623156-195623178 AAGGGATGTGAATCTTGGTGGGG + Intergenic
968170511 3:196505909-196505931 AAGGGGCATTACTGGTGGTGGGG - Intergenic
968227780 3:196986074-196986096 AAAGAAAATAAATGTTAGTGAGG + Intergenic
968308916 3:197666931-197666953 AAGGGATGTGAATCTTGGTGGGG - Intergenic
968535848 4:1128466-1128488 AAGGGACTTAAATGGTGGTAAGG + Intergenic
969777938 4:9373393-9373415 AAGGAACAGAAGTGTTGTTGTGG - Intergenic
970044122 4:11830620-11830642 AAGAGAAAGAAATGTTGGTAAGG + Intergenic
972618931 4:40727254-40727276 AAGGAAACTAAGTGTTGGTGAGG - Intergenic
973545752 4:51980244-51980266 AAGGGAGATAAATGTAGCGGGGG - Intergenic
976055104 4:81055331-81055353 GGGGTACACAAATGTTGGTGTGG + Exonic
976322983 4:83736552-83736574 AAGGAACATAAAGTTTGGTTTGG + Intergenic
977377801 4:96229364-96229386 AAGGGAGAAAAATGGGGGTGGGG + Intergenic
977622535 4:99153788-99153810 AAAAGTAATAAATGTTGGTGTGG - Intronic
977714841 4:100170712-100170734 AAGGGACATAACTTTGGGTGAGG - Intergenic
978091546 4:104723113-104723135 AGGGGACATAAAAGATGCTGTGG + Intergenic
978281798 4:107025596-107025618 AAGGGACAAAAGTGGTGGTGGGG - Intronic
978339101 4:107702999-107703021 AAAAGACAAAAGTGTTGGTGAGG - Intronic
978898449 4:113919634-113919656 AAGGGACATGTGTGATGGTGTGG + Intronic
978972215 4:114822343-114822365 AAAGGACTAAAATGTTGGTCTGG + Intergenic
979648329 4:123099012-123099034 ATGAAAGATAAATGTTGGTGAGG - Intronic
979658316 4:123223186-123223208 AAAGGCAATAAAAGTTGGTGAGG - Intronic
980320990 4:131274895-131274917 AAGTGAGAAAAATGTTGGTTTGG - Intergenic
982127128 4:152193768-152193790 AAGAGAGATAAATGGTGGCGAGG - Intergenic
982701068 4:158660148-158660170 AGGGGACATAACTGATGGTCCGG - Intergenic
983496526 4:168448541-168448563 AAGAAACAAAAATGTTGCTGTGG + Intronic
984381772 4:179002288-179002310 GAGGGACTAAAATGCTGGTGTGG - Intergenic
984735823 4:183107066-183107088 AAGAGAGAGAAGTGTTGGTGAGG - Intronic
985750803 5:1673194-1673216 AAGGGACATGGAAGGTGGTGAGG + Intergenic
987615201 5:20265163-20265185 AAAGGACATAAATATTAGGGAGG - Intronic
988089133 5:26513076-26513098 AGTGGACATAAATTTGGGTGAGG - Intergenic
988296249 5:29366272-29366294 ATGAGAAATAAATGTTGGTGAGG - Intergenic
989082819 5:37642645-37642667 ACAGGAAATAAATGCTGGTGAGG - Intronic
990779408 5:59342557-59342579 AAAGTACATAAATTTTGGGGAGG + Intronic
993235402 5:85301635-85301657 AAAGGACATAATTTATGGTGAGG - Intergenic
993850500 5:93001726-93001748 AATAGACACAAAGGTTGGTGAGG + Intergenic
994015664 5:94962137-94962159 AAAAGAAATAGATGTTGGTGTGG + Intronic
996060117 5:119023728-119023750 AAGGGACATAAAGTCTGGTCTGG + Intergenic
996264790 5:121525837-121525859 ATGAAAGATAAATGTTGGTGAGG + Intergenic
996641939 5:125765448-125765470 AAAAGAAATAAATGCTGGTGAGG - Intergenic
997576751 5:134984614-134984636 AAGCAACATAGATGTTGGTGTGG + Intronic
997960044 5:138313941-138313963 AAGGGACATAGGTGTTTGGGAGG - Intronic
998356771 5:141544732-141544754 ATGAGACTTAAGTGTTGGTGAGG + Intronic
999566057 5:152863110-152863132 AAATGACATAAATTTTTGTGAGG - Intergenic
1000034964 5:157439381-157439403 AGAGAAAATAAATGTTGGTGAGG + Intronic
1000216827 5:159166231-159166253 AAGGGACAAAAAACTTGATGAGG - Intronic
1000650690 5:163815002-163815024 AAGGTACATACATGGTAGTGTGG - Intergenic
1001793402 5:174481216-174481238 AAAAGACAAAAGTGTTGGTGAGG + Intergenic
1001842536 5:174891342-174891364 AAAGAAAATAAATGTTAGTGAGG + Intergenic
1003263190 6:4542661-4542683 ATGAAAGATAAATGTTGGTGAGG + Intergenic
1003897778 6:10623920-10623942 AAGGACCAAAAATGTTGGTGAGG - Intronic
1004692032 6:18000610-18000632 AAAAGATATAAGTGTTGGTGAGG + Intergenic
1005212431 6:23482157-23482179 AAGGGAAATAAATATTGGCTTGG + Intergenic
1006997119 6:38271469-38271491 ATGGGCCAGAAATGTTAGTGAGG + Intronic
1008195619 6:48516509-48516531 AAGGGGCATAAATGTGGTTCTGG - Intergenic
1008317949 6:50069995-50070017 AGGGGATATAAATGGAGGTGTGG + Intergenic
1008444118 6:51568842-51568864 AAGGGAAATGAATGTTGGGTAGG - Intergenic
1009042561 6:58196925-58196947 AAGACACATTAATGCTGGTGTGG - Intergenic
1009218399 6:60951153-60951175 AAGACACATTAATGCTGGTGTGG - Intergenic
1009558685 6:65209623-65209645 ATGGAACATACATGTTTGTGGGG + Intronic
1010665451 6:78624462-78624484 AATGGACATAACTGTTCTTGAGG - Intergenic
1012098755 6:95001895-95001917 AAGTGAAATTAATGTTGGAGAGG - Intergenic
1013429132 6:110040326-110040348 AAGGTTCATAAATGCTGGTAAGG - Intergenic
1013969871 6:116004176-116004198 AAAAAAAATAAATGTTGGTGTGG - Intronic
1014887525 6:126799720-126799742 ACAAGAGATAAATGTTGGTGAGG + Intergenic
1015561495 6:134520928-134520950 AAGGGAATTGCATGTTGGTGGGG + Intergenic
1016267432 6:142248532-142248554 AAGGGAGAGAAATGTTGAAGAGG + Intergenic
1016269435 6:142271644-142271666 AACAAAGATAAATGTTGGTGAGG - Intergenic
1016373500 6:143397665-143397687 ATGGGACCCAAATGTTTGTGTGG - Intergenic
1016572048 6:145524432-145524454 AAAGGTGAAAAATGTTGGTGGGG - Intronic
1021154164 7:17188997-17189019 AGAGGAAATAAGTGTTGGTGAGG - Intergenic
1021617999 7:22522227-22522249 AAAGGACATAAGTGGTGGTTGGG - Intronic
1022090165 7:27102866-27102888 AAAATACATATATGTTGGTGTGG + Intergenic
1022338059 7:29441773-29441795 AAGGAAAATAAGTATTGGTGAGG + Intronic
1022927590 7:35071707-35071729 AAAGGACATAAGTGGTGGTTGGG - Intergenic
1023111794 7:36820505-36820527 AAGGAAAATAAATTTTTGTGAGG + Intergenic
1023531655 7:41162906-41162928 AAGGATGATAAATGGTGGTGAGG + Intergenic
1023760375 7:43460172-43460194 AAGGGAGATAAATGTGGATTTGG + Intronic
1023836223 7:44069359-44069381 AAGGGACCTAGATGGTAGTGAGG + Intronic
1024020934 7:45368257-45368279 ATGAAACATAAATGTTGGTGAGG - Intergenic
1026157072 7:67835736-67835758 AATATACATAAATGTTGGTTAGG + Intergenic
1028035845 7:85980949-85980971 ATGGGATATAAATGTGTGTGTGG - Intergenic
1028374678 7:90133881-90133903 AAAGGACATAAGTGGTGGTTGGG + Intergenic
1030121639 7:106115578-106115600 AAAGGAGATAAATATTGGTTGGG - Intergenic
1030429919 7:109431989-109432011 AAAAAACATAGATGTTGGTGTGG - Intergenic
1030965141 7:115982588-115982610 AATGGACATTAATGATGGTTGGG + Intronic
1031740421 7:125422872-125422894 AAAAAAAATAAATGTTGGTGTGG + Intergenic
1031769643 7:125828040-125828062 ACAGAACATAAATGTTGGTGAGG - Intergenic
1033974727 7:147087158-147087180 AAGGGAAATAAATGCTGCAGAGG - Intronic
1034094144 7:148390857-148390879 GAGGGACATTTATGTTGGTCAGG + Intronic
1034597682 7:152214060-152214082 CAAAGACATAAGTGTTGGTGAGG + Intronic
1035091044 7:156310657-156310679 AAAGATAATAAATGTTGGTGAGG - Intergenic
1035975784 8:4309788-4309810 AAGGGACCTATATGGAGGTGAGG - Intronic
1036275394 8:7347352-7347374 AAGGAACAGAAGTGTTGTTGTGG - Intergenic
1036345959 8:7962999-7963021 AAGGAACAGAAGTGTTGTTGTGG + Intergenic
1036429026 8:8672530-8672552 ATGGGAAACAAGTGTTGGTGAGG + Intergenic
1036841286 8:12123751-12123773 AAGGAACAGAAGTGTTGTTGTGG + Intergenic
1036863092 8:12370004-12370026 AAGGAACAGAAGTGTTGTTGTGG + Intergenic
1038599344 8:28923755-28923777 AAAAGAAAAAAATGTTGGTGAGG - Intronic
1039339663 8:36633696-36633718 AATGGTCACAAATTTTGGTGGGG - Intergenic
1039469960 8:37807231-37807253 AAGGGACATAAATGTTGGTGAGG - Intronic
1040600110 8:48874493-48874515 AAGGGACATAAATGGAAGTATGG + Intergenic
1041437647 8:57860239-57860261 AAGGGACATAAAGGTGAGTGTGG + Intergenic
1041622190 8:59984559-59984581 ATGAAAGATAAATGTTGGTGAGG - Intergenic
1041658987 8:60382697-60382719 AAGGTACATACTTTTTGGTGTGG + Intergenic
1042377262 8:68066372-68066394 AAAAGACAGAAGTGTTGGTGAGG - Intronic
1043050390 8:75377861-75377883 AATGGAAAAAAATATTGGTGAGG - Intergenic
1044256503 8:90069670-90069692 GAGGAACATAAATGTTGGGGAGG + Intronic
1044664362 8:94620680-94620702 AAGGGACAGAAAAGAAGGTGGGG - Intergenic
1047055813 8:121164105-121164127 AGGGAACATCAATGTTGGTGGGG - Intergenic
1047727129 8:127693793-127693815 AAGGGATATAAATGGAAGTGAGG + Intergenic
1048984347 8:139725875-139725897 ATAGCACATAAATGTTGGTGAGG - Intergenic
1049240048 8:141533108-141533130 AAGGGTCATAGATGGTGGTGCGG - Intergenic
1050842919 9:10175225-10175247 AAGAGACTGAAATTTTGGTGAGG - Intronic
1051276142 9:15400807-15400829 AGGGGCCAGAAATGTTTGTGGGG - Intergenic
1052265578 9:26568255-26568277 ATGGAATATAAGTGTTGGTGAGG - Intergenic
1052567920 9:30182200-30182222 AAGAAACATGAATGTTGGTCAGG - Intergenic
1053236481 9:36459269-36459291 AAGGGACAGAAATGTTCTGGGGG + Intronic
1054200085 9:62072181-62072203 AGGTGACATACATGATGGTGGGG - Intergenic
1054638270 9:67516179-67516201 AGGTGACATACATGATGGTGGGG + Intergenic
1054737291 9:68768100-68768122 AATAGACATAAATATTGGGGAGG + Intronic
1055200315 9:73650667-73650689 ATGGAAGATAAGTGTTGGTGAGG + Intergenic
1055531352 9:77187380-77187402 AGAGAAAATAAATGTTGGTGAGG - Intronic
1056189463 9:84170807-84170829 CAGGGACAACAATGTTGGGGAGG - Intergenic
1056743580 9:89281490-89281512 CATGGACATTAATGTTGGAGAGG + Intergenic
1057015962 9:91652481-91652503 AAGGGACCCAAATGGTGGTAAGG + Intronic
1057609234 9:96525888-96525910 AAGGGACATAAATTTGAGGGGGG + Intronic
1059526628 9:114997220-114997242 AAAGGAAACAAATGTTGGTGAGG - Intergenic
1060413831 9:123416946-123416968 AAGTGAAAGAAATATTGGTGGGG + Intronic
1060527594 9:124329170-124329192 AAGGGAAGTAAATGTTTGAGGGG - Intronic
1061978146 9:134083347-134083369 AAGGAAAATAAATGTTGGCAAGG + Intergenic
1186006327 X:5076554-5076576 AAGGGAAATAAATGATTGTTAGG - Intergenic
1186326081 X:8478132-8478154 AATGGAGATATATCTTGGTGAGG - Intergenic
1186564412 X:10646673-10646695 AAGGGACATTAATAATGGTTAGG + Intronic
1187495946 X:19795953-19795975 GAGGGACATTAGTGTAGGTGAGG - Intronic
1188115635 X:26239081-26239103 AAGGGAGAAAAATGTTTTTGTGG - Intergenic
1188279086 X:28240372-28240394 AAGGAAGATAAGTTTTGGTGAGG - Intergenic
1188614617 X:32142332-32142354 AAGGGCCGTAAAGGTTGGTGAGG - Intronic
1189214448 X:39311146-39311168 AAGGGTGATAAATGTGGGTCAGG + Intergenic
1189370510 X:40424575-40424597 AAAGAAAATAAGTGTTGGTGAGG - Intergenic
1189718397 X:43888359-43888381 AAGAGAGATAAGTGTTGGTGAGG - Intergenic
1189760589 X:44317866-44317888 ATGAAAAATAAATGTTGGTGAGG + Intronic
1189860799 X:45269803-45269825 ATGAAACATAAATGTTTGTGAGG - Intergenic
1190444578 X:50510628-50510650 AAGGGACATAAAGGGAGGTAAGG + Intergenic
1191031019 X:55971899-55971921 ACAGGAAATAAATGCTGGTGAGG + Intergenic
1192559647 X:72118125-72118147 AAGTCAAACAAATGTTGGTGCGG - Intergenic
1193473509 X:81935050-81935072 GAAGGACATAAATTTTGGGGAGG + Intergenic
1195112565 X:101662038-101662060 AGGGGGCATAAATGTTGGAAAGG - Intergenic
1196659410 X:118253930-118253952 ATGGGACTTAAATGGTGATGGGG - Intergenic
1197245852 X:124165767-124165789 AAGGAAAATAAGTGTTGGTAAGG - Intronic
1197986202 X:132268951-132268973 AAGAGACATAACTGTTGGCAGGG - Intergenic
1198221501 X:134606515-134606537 AAGAAAAATAGATGTTGGTGAGG + Intronic
1199327743 X:146520425-146520447 AAGGGACATTAAGGGTGGTAAGG + Intergenic
1199735789 X:150685678-150685700 AAGGGACAGAAATGTCTGGGAGG - Intergenic
1199784716 X:151094590-151094612 TTGGAAGATAAATGTTGGTGAGG - Intergenic
1199866408 X:151853785-151853807 AAGGGAAATAAAAGTTGTTCTGG + Intergenic
1199922548 X:152424305-152424327 AAGAGAAATAAATGTTTTTGAGG - Intronic
1200341202 X:155398049-155398071 AAAGATAATAAATGTTGGTGAGG + Intergenic
1200345939 X:155448746-155448768 ATGGGAGAAAAATGTAGGTGGGG + Intergenic
1201930943 Y:19346379-19346401 CAGGGACAAAAATGTATGTGGGG - Intergenic