ID: 1039469961

View in Genome Browser
Species Human (GRCh38)
Location 8:37807236-37807258
Sequence ACTGCAAGGGACATAAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 157}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039469961_1039469972 26 Left 1039469961 8:37807236-37807258 CCAACATTTATGTCCCTTGCAGT 0: 1
1: 0
2: 0
3: 5
4: 157
Right 1039469972 8:37807285-37807307 ACGGAGGGACGGGAAGCCACAGG No data
1039469961_1039469970 16 Left 1039469961 8:37807236-37807258 CCAACATTTATGTCCCTTGCAGT 0: 1
1: 0
2: 0
3: 5
4: 157
Right 1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG No data
1039469961_1039469968 11 Left 1039469961 8:37807236-37807258 CCAACATTTATGTCCCTTGCAGT 0: 1
1: 0
2: 0
3: 5
4: 157
Right 1039469968 8:37807270-37807292 CATGTGAAGGCAGCCACGGAGGG No data
1039469961_1039469966 7 Left 1039469961 8:37807236-37807258 CCAACATTTATGTCCCTTGCAGT 0: 1
1: 0
2: 0
3: 5
4: 157
Right 1039469966 8:37807266-37807288 AATGCATGTGAAGGCAGCCACGG No data
1039469961_1039469969 15 Left 1039469961 8:37807236-37807258 CCAACATTTATGTCCCTTGCAGT 0: 1
1: 0
2: 0
3: 5
4: 157
Right 1039469969 8:37807274-37807296 TGAAGGCAGCCACGGAGGGACGG No data
1039469961_1039469965 -2 Left 1039469961 8:37807236-37807258 CCAACATTTATGTCCCTTGCAGT 0: 1
1: 0
2: 0
3: 5
4: 157
Right 1039469965 8:37807257-37807279 GTCAGGCTAAATGCATGTGAAGG No data
1039469961_1039469967 10 Left 1039469961 8:37807236-37807258 CCAACATTTATGTCCCTTGCAGT 0: 1
1: 0
2: 0
3: 5
4: 157
Right 1039469967 8:37807269-37807291 GCATGTGAAGGCAGCCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039469961 Original CRISPR ACTGCAAGGGACATAAATGT TGG (reversed) Intronic
903764398 1:25724622-25724644 AGTGCAAAGGACATGAATGCAGG + Intronic
907281585 1:53350547-53350569 ACTGCAAGGGTCACAGATATGGG - Intergenic
908713664 1:67046888-67046910 ACTTGAAGGGAAATGAATGTTGG - Intronic
909527627 1:76644458-76644480 TATGCAAAGGACATAAATTTTGG - Intergenic
916333495 1:163644478-163644500 ACTCCAAGACACATAATTGTCGG - Intergenic
917275221 1:173324041-173324063 ACTCCAAGACACATAATTGTCGG + Intergenic
918464223 1:184805628-184805650 ACTGCATGGGATGTAAAAGTAGG - Intronic
918760336 1:188396870-188396892 ACTGCGAGGAACCTGAATGTGGG - Intergenic
918973239 1:191447243-191447265 ACTCCAAGACACATAATTGTCGG - Intergenic
919503081 1:198362670-198362692 AATGCAAGTGACATTAATGATGG - Intergenic
921638158 1:217522507-217522529 ATTGCAAGGTTCATAAATGAGGG - Intronic
1063144140 10:3281069-3281091 CCTGCAAATGACATAGATGTGGG - Intergenic
1066258605 10:33706298-33706320 ATTCCAAGGGATATAAATTTAGG + Intergenic
1077806324 11:5594797-5594819 ATTCCAAGGGACTTAAATGTTGG + Intronic
1078975656 11:16472965-16472987 AATGCAAGTTACTTAAATGTAGG + Intronic
1081151426 11:39637647-39637669 AGTGCTTGGGATATAAATGTGGG + Intergenic
1085744053 11:79099729-79099751 ACCACAAGGAACATAAAAGTTGG + Intronic
1085995046 11:81901864-81901886 ACTCCAAGACACATAATTGTCGG + Intergenic
1086854601 11:91851108-91851130 ACTGGAAGAGAGATAAATGCAGG + Intergenic
1090212595 11:124932974-124932996 ACTGCCAGGAACTTAAATTTTGG + Intronic
1093110420 12:15145237-15145259 AAAGCAAGGGAGATAAATTTTGG + Intronic
1095151173 12:38798228-38798250 ACTCCAAGACACATAATTGTCGG + Intronic
1095365632 12:41400885-41400907 AATGCAAAGGATATAAATGCAGG - Intronic
1096722944 12:53537678-53537700 ACTGCATGTCAAATAAATGTGGG + Intronic
1096776868 12:53969628-53969650 ACTGTAAGGGAGAGAAATATAGG + Intergenic
1097703853 12:62847400-62847422 ACTGCAAGGGCCGTGAAGGTAGG + Intronic
1098510628 12:71309812-71309834 ACTGTATGGGATATAATTGTTGG + Intronic
1098718293 12:73860751-73860773 CCGGCATGGGACAAAAATGTAGG + Intergenic
1100263900 12:92957872-92957894 ACTTCAAGGGACTGAAATGAAGG - Intergenic
1102953082 12:117042800-117042822 AAGGCGAGGGACATAAATCTCGG + Intronic
1105285806 13:19002280-19002302 AATGAAAGGGACTTGAATGTAGG + Intergenic
1107263850 13:38527278-38527300 ACAGCAAGTGACATAAAGTTAGG - Intergenic
1108917422 13:55632557-55632579 GTTGCAAGGGAAAAAAATGTGGG - Intergenic
1111491163 13:88977194-88977216 ACTGAGAGGGACATATATATAGG - Intergenic
1113150516 13:107258242-107258264 ACTTCTAATGACATAAATGTGGG + Intronic
1113179263 13:107607138-107607160 ACTACAAGGGCCCAAAATGTAGG + Intronic
1120074939 14:80145460-80145482 ACTGCAAGGGGTAGAAATGGAGG - Intergenic
1120292318 14:82590782-82590804 TCTGAGAGGGACATAAATTTGGG + Intergenic
1123213252 14:106781868-106781890 ACTGGAAGTAACATAAATGGAGG - Intergenic
1123473965 15:20575477-20575499 ACTGTAAAGGAAATAAATGGTGG + Intergenic
1123644043 15:22424876-22424898 ACTGTAAAGGAAATAAATGGTGG - Intergenic
1123734265 15:23170489-23170511 ACTGTAAAGGAAATAAATGGTGG + Intergenic
1125316032 15:38432478-38432500 ACAGGAAGGGGAATAAATGTTGG - Intergenic
1127240384 15:57107047-57107069 ACTTCATGGAACACAAATGTTGG - Intronic
1129890880 15:79071096-79071118 TATGCAAGGGAGATGAATGTTGG + Intronic
1130165422 15:81452439-81452461 ACTGCAGGGGATAAAAAGGTTGG - Intergenic
1132115351 15:99131727-99131749 GCTGCAAGGCACATAAAACTCGG + Exonic
1136656580 16:31712867-31712889 ACTGCTCAGGACATAACTGTGGG - Intergenic
1137444792 16:48525165-48525187 ACTGCTAGGGACAAAACAGTGGG - Intergenic
1138121308 16:54402812-54402834 ACTGTAAGTGACATCAATGATGG + Intergenic
1140467271 16:75192565-75192587 ATTGCCAGTGACAAAAATGTTGG + Intergenic
1140839146 16:78822751-78822773 AATGCAAGGGAACTAAAGGTAGG + Intronic
1143265888 17:5637212-5637234 ACTACAAGTGATATAATTGTAGG + Intergenic
1144148983 17:12425059-12425081 ACTGAATGGGAGATAAAGGTGGG - Intergenic
1144630006 17:16866500-16866522 ACAGCAAAGTACACAAATGTTGG - Intergenic
1144651371 17:17009307-17009329 ACAGCAAAGTACACAAATGTTGG + Intergenic
1145742910 17:27291323-27291345 ACTGAGATGGATATAAATGTTGG + Intergenic
1147592110 17:41690255-41690277 TCTGCTGGGGACATAAAAGTTGG + Intronic
1149135073 17:53354412-53354434 ACTGCAGGGGAAATAAATAAAGG + Intergenic
1149840153 17:59956043-59956065 ACTGCAAGAGACATGATTTTTGG + Intronic
1153341681 18:3981428-3981450 CCTGCTAGGGCCATACATGTAGG + Intronic
1153409675 18:4779577-4779599 ACTGCAGTAGACATATATGTTGG - Intergenic
1156074230 18:33253760-33253782 AGTGGAAAGAACATAAATGTTGG + Intronic
1156278466 18:35607912-35607934 GCTGGAAGGGACATGAATATTGG + Intronic
1157482631 18:48065256-48065278 ACTTTGAGTGACATAAATGTTGG + Intronic
1159570230 18:70103950-70103972 ACTCCAAGGCACATAATTGTCGG - Intronic
1161162985 19:2770895-2770917 ACTGCGAGGGAAATCAATCTTGG + Intronic
1164669772 19:30065812-30065834 ACTGCAAGTGACATAAACCCAGG + Intergenic
925894617 2:8461701-8461723 ACTACATGGGACATAAAAATGGG + Intergenic
926709277 2:15864230-15864252 ACTGCAAAAGAAATAAATGATGG + Intergenic
927575389 2:24197877-24197899 ACTCCAAGACACATAATTGTCGG - Intronic
932526853 2:72479462-72479484 ACTACAGGGGACATAAATCATGG + Intronic
933532414 2:83527011-83527033 ACTGCAAGCCACATATATTTTGG - Intergenic
935071229 2:99695511-99695533 ACTGCAGGGGAAAAAAATCTGGG + Intronic
937350905 2:121160669-121160691 TCTGCAAGGGACTAAAATATGGG + Intergenic
937412959 2:121692334-121692356 ACTGAATGGGAAATAAAGGTGGG + Intergenic
938688716 2:133766396-133766418 ACTGCAAGAGAGATAAAGGTGGG + Intergenic
942172914 2:173304923-173304945 ACTGAAAGGAAAATAAATCTTGG - Intergenic
942612540 2:177756740-177756762 ACTTCAAGGGACATGTTTGTGGG - Intronic
945398446 2:209350481-209350503 ACAGCAAGTCACATAAACGTTGG - Intergenic
946564603 2:220949937-220949959 ACTACAAGTGACATAAATTTTGG - Intergenic
947855423 2:233320608-233320630 ACTGCAAGGGAGATGAAGGCAGG - Exonic
948373629 2:237505874-237505896 ACTGCAGAGGACAGTAATGTGGG + Intronic
1174694256 20:52541525-52541547 ACAGCATGGGACATATTTGTGGG + Intergenic
1177230027 21:18307726-18307748 ATTGGAAGGAACGTAAATGTAGG + Intronic
1177309310 21:19368440-19368462 ACAGCAGGGCAGATAAATGTGGG + Intergenic
1177630336 21:23718974-23718996 GCTGCCAGGGAAACAAATGTGGG - Intergenic
1178179382 21:30142663-30142685 AATGCAAGGGAAATAATTGGTGG + Intergenic
949166706 3:951394-951416 ACTGAAGTGGACATAAATTTGGG + Intergenic
949828422 3:8186957-8186979 ATAGCAAGGAACATAAATATAGG + Intergenic
951567434 3:24025050-24025072 AGTGCAATAGAAATAAATGTAGG + Intergenic
955157521 3:56431347-56431369 ACTGAAAGTGACATAATTGAAGG - Intronic
955888955 3:63630530-63630552 ACTGCCAGGGAGAAAGATGTTGG - Intergenic
957918601 3:86718528-86718550 AGTGCAAAAGACATAACTGTGGG - Intergenic
959677517 3:109053318-109053340 ACTGTAATGAACATACATGTGGG - Intronic
961599557 3:128050041-128050063 ATTGCTAGTGACAGAAATGTTGG - Intergenic
962979931 3:140479160-140479182 ACTGCAAAGGAGACAAATTTTGG + Intronic
963410689 3:144923271-144923293 TCTGCAAGGGAAATAACTGCAGG - Intergenic
965661885 3:171050646-171050668 ATTGCATGGGACAAAAATGAAGG - Intergenic
969437036 4:7194182-7194204 ACAGCAAGGCACAGAAATGAGGG - Intronic
972078351 4:35115936-35115958 ACTGCACAGGACAGAAATCTAGG - Intergenic
974900973 4:67997656-67997678 TGGGCAGGGGACATAAATGTGGG + Intergenic
978274804 4:106936645-106936667 ACTCCAAGACACATAATTGTCGG + Intronic
980216197 4:129855447-129855469 ACTCCAAGACACATAATTGTCGG + Intergenic
981088048 4:140704033-140704055 ACTACAAGTGTCATATATGTTGG + Intronic
981129134 4:141138795-141138817 ATTCCAAAGGACATATATGTTGG + Intronic
982265474 4:153534816-153534838 ACTGCAAAGGACTTTAAGGTAGG + Intronic
983840392 4:172450486-172450508 AATGCAAGGGACAAAAATAGAGG - Intronic
985755412 5:1711358-1711380 ACTCCAAGACACATAACTGTCGG + Intergenic
986176680 5:5358573-5358595 ACACCAGGGGACATACATGTTGG - Intergenic
986847771 5:11775761-11775783 ATTCCAGTGGACATAAATGTCGG - Intronic
989804295 5:45584991-45585013 ACTCCAAGACACATAATTGTCGG - Intronic
992906187 5:81348256-81348278 ACAGGAAGGGGCAGAAATGTTGG + Intronic
993645806 5:90459589-90459611 CGTGTAAGGGACATAAATGGAGG - Exonic
994011537 5:94909275-94909297 ACTGCATGGGACAAAGATGCTGG - Exonic
995624273 5:114059394-114059416 AGGGCAAGAGTCATAAATGTGGG + Intergenic
998592848 5:143496392-143496414 ACTGGAAGAGCGATAAATGTAGG - Intergenic
998838115 5:146224271-146224293 AGTGCCTGGCACATAAATGTTGG + Intronic
1000666370 5:164002865-164002887 AATTCAAGGAACATAAATGTAGG + Intergenic
1003264233 6:4551538-4551560 ACTGCAAGGTGCATAATGGTGGG + Intergenic
1007027416 6:38590880-38590902 GATTCAAGGGATATAAATGTGGG - Intronic
1007341600 6:41194265-41194287 ACTGGAAGTGACATAAAGGATGG - Intronic
1007968081 6:46022300-46022322 ACTGCTAGGTACATAAAAGCTGG - Intronic
1008145576 6:47887917-47887939 ACTGCCAGGGACATGTATGATGG + Intronic
1008769641 6:54962965-54962987 ACTCCAAGACACATAATTGTCGG + Intergenic
1009540530 6:64951198-64951220 AGTGCAAGGAAGATAAAAGTTGG + Intronic
1011538561 6:88405020-88405042 AATGTAGGGGACAGAAATGTGGG + Intergenic
1012094727 6:94943673-94943695 ACTCCAAGACACATAATTGTCGG + Intergenic
1012499223 6:99870070-99870092 AATGAGAGGGACATAGATGTTGG - Intergenic
1026471628 7:70698050-70698072 ACTGCAAGGGACAGGGATCTTGG + Intronic
1026478744 7:70760813-70760835 ACAGCACTGGACAGAAATGTCGG + Intronic
1027827334 7:83132994-83133016 TCTTAAAGGGACATAAATTTTGG - Intronic
1028593684 7:92525847-92525869 ATTGAAAGGGAGACAAATGTGGG + Intronic
1030553175 7:110990407-110990429 ACAGCAGGGGTGATAAATGTTGG - Intronic
1033950336 7:146777425-146777447 ACAGCAAGAAACATACATGTAGG + Intronic
1034583194 7:152064915-152064937 ACTCCAAGGCACATAATTGGCGG - Intronic
1035025479 7:155822218-155822240 AGTTCAAGGGACAGAAATGCAGG - Intergenic
1036479468 8:9125501-9125523 ACAGCAAGGGTCATAGGTGTAGG + Intergenic
1038996592 8:32929787-32929809 ACTCCAAGTGAAATAAATTTAGG - Intergenic
1039359571 8:36861253-36861275 ATTGCAAGTGACACAAATATAGG - Intronic
1039424489 8:37474775-37474797 ACTGTAAAGGACAGAAATATAGG + Intergenic
1039469961 8:37807236-37807258 ACTGCAAGGGACATAAATGTTGG - Intronic
1040273490 8:45984489-45984511 ACTCCAAGACACATAATTGTCGG - Intergenic
1040443953 8:47474412-47474434 AATGCAAAGGGTATAAATGTGGG + Intronic
1043367198 8:79547111-79547133 ACTGGAAGGAAAATATATGTTGG - Intergenic
1045764108 8:105646737-105646759 GCTGCAAGGTTCATAAATCTCGG - Intronic
1046896393 8:119478331-119478353 ACTCCAAGACACATAATTGTCGG - Intergenic
1048293553 8:133198235-133198257 AGAGCAAGGGACATACATTTTGG - Intronic
1048624145 8:136166340-136166362 ACTTCAAAGAACTTAAATGTAGG - Intergenic
1050451010 9:5781147-5781169 ACTCCAAGACACATAATTGTCGG + Intronic
1050500973 9:6297023-6297045 ACTCCAAGACACATAATTGTCGG + Intergenic
1051214420 9:14780768-14780790 ACAGCAAGCAACATAAATTTAGG + Intronic
1051840409 9:21391170-21391192 GCTGGAAGGGACATCAATTTGGG + Intergenic
1051905867 9:22094280-22094302 ACTCCAAGACACATAATTGTCGG - Intergenic
1052278399 9:26704616-26704638 ACTGCAATGAAAATAAAAGTCGG - Intergenic
1187402680 X:18975575-18975597 ACTGCAATGGAGAAAATTGTGGG - Intronic
1187968726 X:24638638-24638660 ACTGTTAGGGAAATAAATGCAGG - Intronic
1188816131 X:34716618-34716640 ACTGCAGAGAACAAAAATGTGGG + Intergenic
1194337384 X:92665132-92665154 ACAGCAGGGGATATAAAAGTAGG + Intergenic
1197440794 X:126487080-126487102 ACTTGAAGAGACAGAAATGTTGG - Intergenic
1197837270 X:130708961-130708983 ACTTCAAGGAAGATAAATCTGGG + Intronic
1198322958 X:135537478-135537500 ACTGCAAGGGACCTTAGAGTTGG + Intronic
1198757055 X:139993470-139993492 ACTCCAAGACACATAATTGTCGG - Intergenic