ID: 1039469963

View in Genome Browser
Species Human (GRCh38)
Location 8:37807249-37807271
Sequence TGCATTTAGCCTGACTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039469963_1039469968 -2 Left 1039469963 8:37807249-37807271 CCCTTGCAGTCAGGCTAAATGCA 0: 1
1: 0
2: 2
3: 6
4: 136
Right 1039469968 8:37807270-37807292 CATGTGAAGGCAGCCACGGAGGG No data
1039469963_1039469970 3 Left 1039469963 8:37807249-37807271 CCCTTGCAGTCAGGCTAAATGCA 0: 1
1: 0
2: 2
3: 6
4: 136
Right 1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG No data
1039469963_1039469972 13 Left 1039469963 8:37807249-37807271 CCCTTGCAGTCAGGCTAAATGCA 0: 1
1: 0
2: 2
3: 6
4: 136
Right 1039469972 8:37807285-37807307 ACGGAGGGACGGGAAGCCACAGG No data
1039469963_1039469967 -3 Left 1039469963 8:37807249-37807271 CCCTTGCAGTCAGGCTAAATGCA 0: 1
1: 0
2: 2
3: 6
4: 136
Right 1039469967 8:37807269-37807291 GCATGTGAAGGCAGCCACGGAGG No data
1039469963_1039469969 2 Left 1039469963 8:37807249-37807271 CCCTTGCAGTCAGGCTAAATGCA 0: 1
1: 0
2: 2
3: 6
4: 136
Right 1039469969 8:37807274-37807296 TGAAGGCAGCCACGGAGGGACGG No data
1039469963_1039469966 -6 Left 1039469963 8:37807249-37807271 CCCTTGCAGTCAGGCTAAATGCA 0: 1
1: 0
2: 2
3: 6
4: 136
Right 1039469966 8:37807266-37807288 AATGCATGTGAAGGCAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039469963 Original CRISPR TGCATTTAGCCTGACTGCAA GGG (reversed) Intronic
900406684 1:2495925-2495947 TGAATTCAGCCTGACTGGACGGG - Intronic
906480300 1:46194978-46195000 GGCAGTTAGCCTGACTGGCATGG + Intronic
912969264 1:114265288-114265310 TGCTTTGAGCTTGATTGCAATGG + Intergenic
913309498 1:117474156-117474178 CGTATTCAACCTGACTGCAAAGG + Intronic
916824700 1:168432216-168432238 TGCTTTTATCCTGAGAGCAATGG + Intergenic
917437582 1:175036666-175036688 AGCAGTTAGCCTGAAGGCAAGGG - Intergenic
923292950 1:232564464-232564486 AGCATGAAGCCTGCCTGCAAGGG + Intergenic
1064462182 10:15545901-15545923 TGATTTTAGCCTAAGTGCAATGG - Intronic
1065455712 10:25904723-25904745 TGCATTTACATTGACTGCATTGG + Intergenic
1067843463 10:49700285-49700307 TGCATTTGGCCTGGATGCACTGG - Intronic
1070448102 10:76528126-76528148 TGCATCTAGCCTCAATGCACAGG - Intronic
1071966145 10:90854740-90854762 GGCATTTAGCCTGTCTAAAATGG - Intronic
1080855855 11:36111062-36111084 TGCATTGAGGCTGACTGCTGGGG + Intronic
1082079820 11:48004052-48004074 TGTATGCAACCTGACTGCAAAGG + Intronic
1083171369 11:60925451-60925473 TGCTCTTAGCCTGACTCCCACGG - Intronic
1085624190 11:78059447-78059469 TGAATCTAGGCTGAGTGCAATGG + Intronic
1086024240 11:82270751-82270773 TCCATTTTGCATCACTGCAAAGG - Intergenic
1086177062 11:83903560-83903582 TATTTTTAGCCTGATTGCAAAGG - Intronic
1086250842 11:84812557-84812579 TGCACTTAAGCTGACTGCTATGG - Intronic
1087493314 11:98856224-98856246 TGCATTTAGGCTGAGTACAGTGG - Intergenic
1090677670 11:129017031-129017053 TGCAATTAGCATGGTTGCAAAGG + Intronic
1090882563 11:130846733-130846755 AGCATTTAGCCTCCCTACAATGG - Intergenic
1092490262 12:8938567-8938589 TGCATATAGGCTGAGTGCAGTGG - Intronic
1093146422 12:15572001-15572023 TACATTTAGCCTGACTTCATAGG + Intronic
1094377220 12:29802640-29802662 GGGCTTTAGCCAGACTGCAAGGG + Intergenic
1095149140 12:38770570-38770592 TGCATTTTTCCTAAATGCAAGGG - Intronic
1097321907 12:58234898-58234920 TGCATTTAGTCTGACCCCAAAGG - Intergenic
1098428551 12:70393590-70393612 TGCATTCAGGCAGACTGCTAAGG - Intronic
1098746014 12:74237701-74237723 TACATTTCTCTTGACTGCAATGG - Intergenic
1098870282 12:75809890-75809912 TTCAATTAGCCTGACACCAAGGG - Intergenic
1101653446 12:106697846-106697868 TGCATTTACCCTGACCTTAAGGG + Intronic
1102086516 12:110145328-110145350 TTCAATTAGGCTGAGTGCAATGG - Intronic
1106628813 13:31448144-31448166 TTATTTTAGACTGACTGCAATGG - Intergenic
1108115460 13:47122694-47122716 TGATTTTATCCTGAATGCAATGG + Intergenic
1110335944 13:74329907-74329929 TGCATTAAGATTGTCTGCAAAGG + Intergenic
1110366885 13:74696690-74696712 AGCATTTAGCCAGAGGGCAAAGG - Intergenic
1111414465 13:87921151-87921173 TGCTTTTATCCTGCCTGTAAGGG + Intergenic
1112066796 13:95801396-95801418 TGCATTTAGGCTGGGTGCAGTGG - Intergenic
1112900835 13:104354724-104354746 TGCTTTTATCCTAACTGCACTGG + Intergenic
1113867073 13:113533362-113533384 TGCTTTAAGCCAGACTGCAGAGG + Intronic
1116414557 14:44665011-44665033 TGCTTTTATCCTGGCTGCACTGG - Intergenic
1122702826 14:103601701-103601723 TGCATTTAGCCAATCTGAAAAGG + Intronic
1126959429 15:53974852-53974874 TGCATTTAGCATGTCAGCAGTGG + Intergenic
1127450044 15:59107713-59107735 TGTTTTTAGCCAGACTACAAGGG + Intronic
1132189502 15:99839460-99839482 AGCCTTTAGCCTGACTCCACAGG + Intergenic
1134857243 16:17530496-17530518 TGCTTTTACCCTAGCTGCAAGGG - Intergenic
1136998464 16:35207774-35207796 TGCATTGCGCATGTCTGCAAGGG + Intergenic
1138970217 16:62134320-62134342 AGCAATTAGCATGACTGAAAGGG - Intergenic
1139382684 16:66543571-66543593 TGCTTCCAGCCTGAGTGCAAAGG - Intronic
1141367859 16:83460704-83460726 TGCAGATAGCCTGAGTGCAGTGG + Intronic
1145718869 17:27049644-27049666 TGCAATTAGCCTGAGTGCTCAGG - Intergenic
1147522710 17:41189904-41189926 AGCATGTAGGCTGACAGCAAGGG - Exonic
1147528410 17:41249738-41249760 AGCATGTAGGCTGACAGCAAGGG - Exonic
1147530420 17:41271328-41271350 AGCATGTAGGCTGACAGCAAGGG - Intergenic
1150850161 17:68696676-68696698 TGCATTATGACTGACTTCAAGGG + Intergenic
1151352156 17:73538109-73538131 TGCACTTGGCCTGGCTGGAAAGG + Intronic
1154470280 18:14693715-14693737 TGCAATTAGCCTGAGTGCTCAGG + Intergenic
1157646953 18:49284137-49284159 TGTATTATACCTGACTGCAAAGG + Intronic
1158399661 18:57110692-57110714 TCCATTTCTCCTGTCTGCAAGGG + Intergenic
1160419996 18:78737461-78737483 TGCACTTACCCTGAGCGCAAGGG + Intergenic
1161616270 19:5272308-5272330 TGCATTTAGGCTGCATGCAGTGG + Intronic
1162841205 19:13357714-13357736 TGCATTTAGGCTGGGTGCAGTGG + Intronic
1163237338 19:16037367-16037389 AGCATTGAGCCTCTCTGCAAGGG - Intergenic
1166031097 19:40129174-40129196 TGCATTTTGCTTGGCTCCAAGGG + Intergenic
1168179760 19:54653470-54653492 TGCCTTTGGCCGGATTGCAAAGG + Intronic
927435524 2:23063098-23063120 TACATAAAGCCTGACTGCACTGG - Intergenic
935245898 2:101218760-101218782 TCCCTTGAGCCTGCCTGCAAAGG - Intronic
936491639 2:112977601-112977623 TGCCTTTAGCCTGACTGCAGAGG + Intronic
937648836 2:124297667-124297689 TGCATATAGTCTGCCTTCAAAGG + Intronic
939104849 2:137937188-137937210 TGCATTCTTCCTAACTGCAAGGG + Intergenic
943848543 2:192685899-192685921 TGCATTTGGGCTGACTACAGAGG - Intergenic
945148997 2:206768132-206768154 TGCATTTATCCTGTAGGCAATGG + Intronic
945731061 2:213535468-213535490 TGCACTTAGCATAAATGCAAAGG - Intronic
946709758 2:222493621-222493643 TACATTTAGGCTGAGTGCAGTGG - Intronic
1170536558 20:17346465-17346487 GCCCTTTAGCCTGCCTGCAATGG + Intronic
1172521386 20:35568793-35568815 TTCATTTATCCTGCCTGCTACGG + Intergenic
1174123375 20:48284044-48284066 TGCATTTAGCCTGAGTCCAGAGG - Intergenic
1175369547 20:58478740-58478762 TGCTTCAAGCCTGACTGTAATGG - Intronic
1176804213 21:13464151-13464173 TGCAATTAGCCTGAGTGCTCAGG - Intergenic
1182886821 22:33781002-33781024 AGCATTTAGCTTGACTTCTAAGG - Intronic
1185328331 22:50238894-50238916 TGGCTTTATCCTGACTGCCAGGG - Intronic
949948541 3:9209738-9209760 TGCATTTAGCCAAACTCCATTGG - Intronic
951040966 3:17988447-17988469 TGCATTTATCTTGACCACAAGGG - Intronic
951724288 3:25739427-25739449 TGGATTTAGCCTGCCAGCCACGG + Intronic
955098081 3:55819921-55819943 TGCATTTTGGCTGCGTGCAATGG + Intronic
955120152 3:56050050-56050072 GGCACTGAGGCTGACTGCAAAGG + Intronic
955505772 3:59631773-59631795 GGCACTTAGCCTTTCTGCAAGGG + Intergenic
955889082 3:63631565-63631587 TGCATTTATCCTGAGGGCAATGG - Intergenic
956014298 3:64865049-64865071 TGAATTTAGCCTGAATGTCAAGG - Intergenic
957445100 3:80306872-80306894 GGCACTTAGCCAGACTGAAATGG + Intergenic
957567697 3:81906141-81906163 TACTTTTACCCTGACTGTAATGG + Intergenic
963182071 3:142368434-142368456 TGCATATAGGCTGAGTGCAGTGG - Intronic
968794694 4:2694941-2694963 TGCAGTGACCCTGACTGCGAAGG + Exonic
969983822 4:11186668-11186690 TGCTTTTATCCTGGCTGCACTGG - Intergenic
969999288 4:11347676-11347698 TGCATTGAGCCTTGCTGCAATGG - Intergenic
976451582 4:85196770-85196792 TGCACTTAGACTGACTATAAAGG - Intergenic
977311984 4:95399478-95399500 TACATTTATCCTAACTGCATGGG - Intronic
981622990 4:146724972-146724994 TCCAGTTACACTGACTGCAATGG - Intronic
988352913 5:30135040-30135062 TGCTTTTATTCTGGCTGCAATGG + Intergenic
989980237 5:50634806-50634828 TGCTTGTAGCCTAGCTGCAAAGG - Intergenic
990042057 5:51387902-51387924 TGCATTGAACCTTGCTGCAAAGG - Intronic
993540679 5:89146897-89146919 TGGAATCAGCCTTACTGCAAGGG + Intergenic
999072805 5:148765474-148765496 TGCATTTAGCCTGAGAAAAATGG - Intergenic
1000448177 5:161350718-161350740 TGCTTTTATCCTGGCTGCACTGG - Intronic
1001193854 5:169654156-169654178 TGCATTGAGCCTGAGTGACAAGG - Intronic
1005841081 6:29744995-29745017 TGCATGTAGTCTGCCTGCACAGG + Intergenic
1009881417 6:69571027-69571049 TGCTTTTATCCTGGCTGCACTGG - Intergenic
1013639772 6:112062028-112062050 CACATTCAGCCTGACTCCAAAGG - Intronic
1015580018 6:134714156-134714178 AGCATGCTGCCTGACTGCAAAGG + Intergenic
1020154788 7:5713954-5713976 TGCATTCTGCTTGACTCCAAAGG + Intronic
1028097851 7:86784576-86784598 TTCACTCAGCCTGACTGAAATGG - Intronic
1028745950 7:94327031-94327053 GGCATTTACTCTGACTGAAATGG + Intergenic
1033880882 7:145882302-145882324 TATATTTTGCCTGACTGCACTGG + Intergenic
1035155127 7:156906123-156906145 TGCATTTACCCTCAGTGCACTGG - Intergenic
1038259622 8:25981469-25981491 TGCATGTTGTCTGACTGCATTGG - Intronic
1038375019 8:27031411-27031433 GGCATTTAGGCTGACTAGAATGG + Intergenic
1039469963 8:37807249-37807271 TGCATTTAGCCTGACTGCAAGGG - Intronic
1040025375 8:42777055-42777077 TGCATTCAGCATGACTGTAGGGG - Intronic
1040399632 8:47035508-47035530 AGCATTGAGCCTGACTGTCAAGG - Intergenic
1040656194 8:49511948-49511970 TGCATGGAGCCAGTCTGCAAAGG - Intergenic
1040742869 8:50601467-50601489 AGCATTTTCTCTGACTGCAATGG - Intronic
1042114935 8:65420732-65420754 TGCTTATAGCCTGACTGAAGAGG - Intergenic
1042823439 8:72956530-72956552 TGCATTTACCTTGACTTCATTGG - Intergenic
1043926861 8:86046453-86046475 TGTATTTCGTCTGAGTGCAATGG - Intronic
1045041735 8:98230990-98231012 TTCAGCTAACCTGACTGCAAGGG + Intronic
1045190714 8:99880151-99880173 TGCATGGAGCCAGTCTGCAAAGG + Intronic
1045538511 8:103058826-103058848 TGCATTTAGCCTCACAGCAATGG - Intronic
1045756546 8:105549899-105549921 TACATTTAGGCTGGGTGCAATGG - Intronic
1046476664 8:114753757-114753779 TGCATTTTGAGTAACTGCAATGG + Intergenic
1047303961 8:123638311-123638333 TGCAGTTACCCTGACTGTAAGGG - Intergenic
1048329805 8:133463857-133463879 TGCATGCACCCTGAGTGCAAAGG + Intronic
1051528562 9:18074900-18074922 TGCATTTCCCCTCACTGGAAAGG + Intergenic
1052104533 9:24496551-24496573 TTGATCTAGTCTGACTGCAAAGG - Intergenic
1052560092 9:30074443-30074465 TGCTTTTAGTCTGGCTGCACTGG + Intergenic
1055671855 9:78615370-78615392 TGCCATTAGTCTTACTGCAATGG + Intergenic
1059224745 9:112661269-112661291 TGCATTTTACCTGAGTGAAATGG - Exonic
1059724551 9:116993112-116993134 TTCATTTGCCCTGAATGCAATGG - Intronic
1060630236 9:125151181-125151203 CACATTCAGCCTGTCTGCAATGG - Intronic
1061626483 9:131843546-131843568 TGGCTTCAGCCTGCCTGCAAGGG - Intergenic
1187065154 X:15827613-15827635 TGCTTTTTGCATGACAGCAACGG - Intronic
1188608762 X:32069739-32069761 TGCATTTTGCCTGAGTTCAGGGG + Intronic
1193278442 X:79619894-79619916 TGGATTAAGCCTGACTGATATGG + Intergenic
1193562454 X:83035439-83035461 AGCATCTAATCTGACTGCAATGG + Intergenic
1195693102 X:107645185-107645207 CACATTCAGCCTGTCTGCAATGG - Exonic
1201456346 Y:14171313-14171335 TACATTTTGCCTGAGTGGAAAGG + Intergenic