ID: 1039469964

View in Genome Browser
Species Human (GRCh38)
Location 8:37807250-37807272
Sequence ATGCATTTAGCCTGACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039469964_1039469972 12 Left 1039469964 8:37807250-37807272 CCTTGCAGTCAGGCTAAATGCAT 0: 1
1: 1
2: 0
3: 5
4: 124
Right 1039469972 8:37807285-37807307 ACGGAGGGACGGGAAGCCACAGG No data
1039469964_1039469966 -7 Left 1039469964 8:37807250-37807272 CCTTGCAGTCAGGCTAAATGCAT 0: 1
1: 1
2: 0
3: 5
4: 124
Right 1039469966 8:37807266-37807288 AATGCATGTGAAGGCAGCCACGG No data
1039469964_1039469970 2 Left 1039469964 8:37807250-37807272 CCTTGCAGTCAGGCTAAATGCAT 0: 1
1: 1
2: 0
3: 5
4: 124
Right 1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG No data
1039469964_1039469968 -3 Left 1039469964 8:37807250-37807272 CCTTGCAGTCAGGCTAAATGCAT 0: 1
1: 1
2: 0
3: 5
4: 124
Right 1039469968 8:37807270-37807292 CATGTGAAGGCAGCCACGGAGGG No data
1039469964_1039469969 1 Left 1039469964 8:37807250-37807272 CCTTGCAGTCAGGCTAAATGCAT 0: 1
1: 1
2: 0
3: 5
4: 124
Right 1039469969 8:37807274-37807296 TGAAGGCAGCCACGGAGGGACGG No data
1039469964_1039469967 -4 Left 1039469964 8:37807250-37807272 CCTTGCAGTCAGGCTAAATGCAT 0: 1
1: 1
2: 0
3: 5
4: 124
Right 1039469967 8:37807269-37807291 GCATGTGAAGGCAGCCACGGAGG No data
1039469964_1039469974 30 Left 1039469964 8:37807250-37807272 CCTTGCAGTCAGGCTAAATGCAT 0: 1
1: 1
2: 0
3: 5
4: 124
Right 1039469974 8:37807303-37807325 ACAGGCCAGCCTTTCGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039469964 Original CRISPR ATGCATTTAGCCTGACTGCA AGG (reversed) Intronic
900406685 1:2495926-2495948 TTGAATTCAGCCTGACTGGACGG - Intronic
900772032 1:4553018-4553040 ATGCCTTTAGTTTGAATGCAGGG - Intergenic
902077515 1:13799674-13799696 ATGCATTTAACTTGGCTGCTGGG - Intronic
904567596 1:31436966-31436988 ATCCACTTAGCCTGTCTGCTGGG + Intergenic
905384491 1:37591974-37591996 AAGCATTTAGCATGGCTGCTGGG - Intronic
909433900 1:75618459-75618481 TTGCAATTAGAATGACTGCAGGG + Intergenic
913050771 1:115114997-115115019 AGGCTTCCAGCCTGACTGCAGGG + Intergenic
923292949 1:232564463-232564485 AAGCATGAAGCCTGCCTGCAAGG + Intergenic
923985767 1:239380129-239380151 ATGAATGTATCCTGAGTGCATGG - Intergenic
1065164896 10:22966183-22966205 CTGTTTTTAGCCTGACTCCATGG + Intronic
1068247349 10:54390140-54390162 ATGCATTCACCCTGAATTCAGGG - Intronic
1076628313 10:131835225-131835247 GAGCATTTAGCCTTACTTCATGG - Intergenic
1078825787 11:14929239-14929261 ATGCCTTGATCCTGAGTGCAAGG + Intronic
1080855854 11:36111061-36111083 GTGCATTGAGGCTGACTGCTGGG + Intronic
1081153085 11:39656271-39656293 ATGCTTCTACACTGACTGCAGGG + Intergenic
1081529939 11:43951335-43951357 ATTCATCTAGCCTGGCTCCAGGG - Intergenic
1085098637 11:73781421-73781443 ATCCATTAAGTCTGGCTGCAAGG - Intergenic
1092927743 12:13287477-13287499 CTGCAGTTAGCCAAACTGCAGGG - Intergenic
1094781023 12:33791584-33791606 ATGTTTTTAGCCTGTTTGCAAGG - Intergenic
1095301478 12:40589603-40589625 AGGCTTTTTGCCTGGCTGCATGG - Intergenic
1095997714 12:48103328-48103350 ATCCATGTATCCTGACTCCAGGG + Intronic
1098870283 12:75809891-75809913 ATTCAATTAGCCTGACACCAAGG - Intergenic
1099055151 12:77830658-77830680 ATGATTTTAGCCTGATTTCATGG + Intergenic
1100047290 12:90398419-90398441 ATTCTTTTAGCCTAACTGAAAGG - Intergenic
1104350930 12:128043380-128043402 ATCTATTTAGACTGACTACAGGG + Intergenic
1104881909 12:132077628-132077650 GTGTCTTTAGCCTGACAGCAGGG - Exonic
1107398475 13:40043838-40043860 GTGCAGTAAGCCTGACTGCAAGG + Intergenic
1110358527 13:74597866-74597888 ATGCTTTTTGCTTGACTGCAGGG - Intergenic
1111414464 13:87921150-87921172 ATGCTTTTATCCTGCCTGTAAGG + Intergenic
1115258121 14:31424198-31424220 ATTCATTTTGCCTGAGTACACGG + Intronic
1115584355 14:34795380-34795402 ATGCATTTAGCTTGATTGCTAGG - Intronic
1118295691 14:64566788-64566810 ACACACTCAGCCTGACTGCAGGG + Intronic
1124483526 15:30097653-30097675 ATGGATTTAGCCATACTGCTCGG + Intergenic
1124489977 15:30149715-30149737 ATGGATTTAGCCATACTGCTCGG + Intergenic
1124520052 15:30399573-30399595 ATGGATTTAGCCATACTGCTCGG - Intergenic
1124538602 15:30566651-30566673 ATGGATTTAGCCATACTGCTCGG + Intergenic
1124753555 15:32388612-32388634 ATGGATTTAGCCATACTGCTCGG - Intergenic
1124760048 15:32440931-32440953 ATGGATTTAGCCATACTGCTCGG - Intergenic
1127622954 15:60751985-60752007 ATGCATTTAACCTATCTCCAGGG + Intronic
1129209957 15:74062710-74062732 ATGCCTGGAGCCTGGCTGCATGG + Intergenic
1129404071 15:75302693-75302715 ATGCCTGGAGCCTGGCTGCATGG - Intergenic
1130258910 15:82339021-82339043 ATGGATTTAGCCATACTGCTCGG - Intergenic
1130269764 15:82440082-82440104 ATGGATTTAGCCATACTGCTCGG + Intergenic
1130462103 15:84167383-84167405 ATGGATTTAGCCATACTGCTCGG + Intergenic
1130473725 15:84246306-84246328 ATGGATTTAGCCATACTGCTCGG + Intergenic
1130481140 15:84360370-84360392 ATGGATTTAGCCATACTGCTCGG + Intergenic
1130490574 15:84427390-84427412 ATGGATTTAGCCATACTGCTCGG - Intergenic
1130502162 15:84506160-84506182 ATGGATTTAGCCATACTGCTCGG - Intergenic
1130596010 15:85250920-85250942 ATGGATTTAGCCATACTGCTCGG + Intergenic
1137510162 16:49092668-49092690 ATCCATTTACCCTACCTGCAGGG - Intergenic
1137860270 16:51839900-51839922 ATGTAGACAGCCTGACTGCATGG - Intergenic
1145725212 17:27114520-27114542 ATGCATTCACCCTGAATTCAGGG + Intergenic
1146657686 17:34644741-34644763 ATGCATTTAGCCTGACTGGAGGG + Intergenic
1147512461 17:41082706-41082728 ATGCAAATAGCCTGAAGGCATGG - Intergenic
1149109777 17:53014485-53014507 ATTCATTTCTCCTAACTGCATGG + Intergenic
1150143210 17:62747211-62747233 ATGCATTCAGCCCAACTACAGGG + Intronic
1155307362 18:24491932-24491954 ATGCATGTAGCTTGACTGATTGG + Intergenic
1162340350 19:10087926-10087948 GTGGATTTAGCCTGCCTGAAAGG + Intronic
1164157107 19:22603536-22603558 ATGGATTTAGCCATACTGCTTGG + Intergenic
1165920774 19:39296717-39296739 ATGAAGTTGGCCTGACAGCATGG - Intronic
1167032995 19:46975889-46975911 ATAGATCTAGGCTGACTGCAGGG - Intronic
1168424803 19:56230859-56230881 AATGATTTTGCCTGACTGCAGGG - Intronic
926038396 2:9653180-9653202 AAGCAGTCAGCCAGACTGCATGG + Intergenic
926495091 2:13576236-13576258 ATGAATTTAGCCTGAGGACAGGG - Intergenic
930258842 2:49121997-49122019 ATGCATGTTGCCTGACTGAGCGG - Intronic
936398290 2:112146799-112146821 ATGTATTTAGCCTTATTACATGG + Intronic
1174037548 20:47677593-47677615 ATGCAATTAACCTGACATCAAGG - Intronic
1175357285 20:58378508-58378530 ACGCATTTAGCCTCACTGTCTGG - Intergenic
1177913902 21:27063796-27063818 ATGCTGTTAGCCTGATTGGATGG - Intergenic
1178175207 21:30089178-30089200 ATAAATTTAGCCTAAGTGCAGGG + Intergenic
1184841920 22:47057089-47057111 CTGCATTCAGCCTGACTCCCAGG - Intronic
951402749 3:22254343-22254365 ATGCATGTACCCTGCTTGCACGG - Intronic
953253026 3:41263620-41263642 ATGCATGGACCATGACTGCAAGG + Intronic
954901574 3:54024666-54024688 CTGGATTTTGCCTGAATGCATGG + Intergenic
957799081 3:85051369-85051391 ATGCATTTAATATGATTGCAAGG - Intronic
958478233 3:94613005-94613027 CTGCATTTTGCCTGAATACATGG - Intergenic
961145158 3:124587007-124587029 CTGTATTGAGCCTGAGTGCATGG + Intronic
962359691 3:134727461-134727483 ATTCATTTGTCCTGACAGCATGG + Intronic
964621837 3:158726603-158726625 AAGCATTTAACTTGACTTCATGG - Intronic
970392230 4:15624814-15624836 AGTCATTTAGTCTGACTACACGG - Intronic
976525458 4:86082925-86082947 AGGTATTTTGCCTGACAGCATGG - Intronic
976700346 4:87963373-87963395 ATGCATTTTGGTTAACTGCATGG + Intergenic
977009827 4:91623318-91623340 ATGCATTTATAGTGTCTGCAGGG - Intergenic
977311985 4:95399479-95399501 TTACATTTATCCTAACTGCATGG - Intronic
978010461 4:103675836-103675858 AGGTATTTAGCCTGAGTGGAGGG + Intronic
987877468 5:23697128-23697150 AGGTATTTTGCCTGACAGCATGG + Intergenic
988325366 5:29759055-29759077 AGGTATTTTGCCTGACAGCAAGG + Intergenic
989218770 5:38931729-38931751 ATGAATTCTGCCTGACTTCAGGG - Intronic
992333972 5:75746345-75746367 ACACTTTTGGCCTGACTGCATGG + Intergenic
998974387 5:147628172-147628194 ATGCATAAAGCCTGGCTGGATGG - Intronic
999365699 5:151022042-151022064 ATCCATTTAGACTGACTCCAAGG - Intronic
1002358474 5:178650321-178650343 GTGGATTCAGCCTCACTGCAAGG - Intergenic
1004431017 6:15543425-15543447 ATGCATGTAGTAAGACTGCATGG - Intronic
1007124803 6:39416971-39416993 ATGAATTTGCCCTGTCTGCACGG - Intronic
1009995409 6:70890266-70890288 AGGCATTTAAAGTGACTGCAGGG - Intronic
1013753986 6:113439598-113439620 ATGCATTGAGGCTGAATCCAGGG + Intergenic
1015079831 6:129210248-129210270 ATGCTTTTAGTCTGAATTCAGGG + Intronic
1015117614 6:129666612-129666634 ATGCCTTCAACCTGACTCCAGGG + Intronic
1016744024 6:147558861-147558883 TTGCATTTAGTCTGTCTCCATGG + Intronic
1016823077 6:148363995-148364017 ATGCATTTACTCTGAATGAATGG - Intronic
1026384711 7:69834733-69834755 AGGCACTTAGCATGACTGCTGGG + Intronic
1028275586 7:88852818-88852840 ATGCAGGCAGCCTGACTCCAAGG + Intronic
1030035457 7:105404872-105404894 ATTCATTTAGGCAGACTGCGAGG - Intergenic
1030949163 7:115767642-115767664 TTGCTATTAGCCTGACTACAAGG + Intergenic
1033508477 7:142030132-142030154 ATGCAGTTAACCTGATGGCAGGG + Intronic
1034965334 7:155387291-155387313 ATCCACTTAGCTTGACTGCTCGG + Intronic
1035853299 8:2943742-2943764 ATGGATTTGGCCTAATTGCATGG + Intronic
1038356380 8:26832812-26832834 AGGCTTTTGTCCTGACTGCATGG - Intronic
1039016394 8:33154235-33154257 CTGCTTTTAGCATGACTGCCTGG + Intergenic
1039469964 8:37807250-37807272 ATGCATTTAGCCTGACTGCAAGG - Intronic
1040025376 8:42777056-42777078 CTGCATTCAGCATGACTGTAGGG - Intronic
1041564573 8:59262194-59262216 ATACCTTTAGCCTGCATGCAGGG + Intergenic
1041784161 8:61612933-61612955 ATGCATATAGCCTGAATGGTGGG - Intronic
1043749809 8:83921493-83921515 ATGCAATTAGCCAAAATGCAGGG + Intergenic
1045041734 8:98230989-98231011 ATTCAGCTAACCTGACTGCAAGG + Intronic
1045451100 8:102326516-102326538 ATGGATTTAGCCTGTCTTAAGGG - Intronic
1047303962 8:123638312-123638334 TTGCAGTTACCCTGACTGTAAGG - Intergenic
1048326997 8:133447546-133447568 AAGCTTTGAGCCTGACTGCCGGG + Intergenic
1049470613 8:142773629-142773651 CTGCATATAGACTCACTGCAAGG + Intronic
1051964772 9:22814114-22814136 CTTCATTTAGGATGACTGCAAGG + Intergenic
1058043342 9:100329817-100329839 ATACAATTAGCCTGACTACATGG + Intronic
1060888115 9:127170099-127170121 ATTTAATTAGCCAGACTGCATGG + Intronic
1061060613 9:128248524-128248546 ATGCCTGGAGCCTGGCTGCATGG + Intronic
1061643904 9:131983247-131983269 ATGGATTTTCCCTCACTGCATGG + Intronic
1187553858 X:20332490-20332512 ATGGGATTAGCCTGACTGCTTGG + Intergenic
1188608761 X:32069738-32069760 GTGCATTTTGCCTGAGTTCAGGG + Intronic
1193272849 X:79549119-79549141 ATACACTTAACCTGACTGTAAGG + Intergenic
1194356191 X:92887545-92887567 ATGCAATTAGCCAGGCTTCATGG + Intergenic
1200397659 X:156000698-156000720 ATGCATCTGCCCTGACTGCCTGG + Intronic
1202367660 Y:24178163-24178185 ATGGATTTAGCCATACTGCTCGG + Intergenic
1202503123 Y:25491960-25491982 ATGGATTTAGCCATACTGCTCGG - Intergenic