ID: 1039469970

View in Genome Browser
Species Human (GRCh38)
Location 8:37807275-37807297
Sequence GAAGGCAGCCACGGAGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039469960_1039469970 21 Left 1039469960 8:37807231-37807253 CCTCACCAACATTTATGTCCCTT 0: 1
1: 0
2: 1
3: 36
4: 321
Right 1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG No data
1039469964_1039469970 2 Left 1039469964 8:37807250-37807272 CCTTGCAGTCAGGCTAAATGCAT 0: 1
1: 1
2: 0
3: 5
4: 124
Right 1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG No data
1039469961_1039469970 16 Left 1039469961 8:37807236-37807258 CCAACATTTATGTCCCTTGCAGT 0: 1
1: 0
2: 0
3: 5
4: 157
Right 1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG No data
1039469963_1039469970 3 Left 1039469963 8:37807249-37807271 CCCTTGCAGTCAGGCTAAATGCA 0: 1
1: 0
2: 2
3: 6
4: 136
Right 1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039469970 Original CRISPR GAAGGCAGCCACGGAGGGAC GGG Intronic
No off target data available for this crispr