ID: 1039470432

View in Genome Browser
Species Human (GRCh38)
Location 8:37809983-37810005
Sequence GGGCACTGGTGTCAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039470432_1039470436 -3 Left 1039470432 8:37809983-37810005 CCTGCACACTGACACCAGTGCCC 0: 1
1: 0
2: 2
3: 20
4: 253
Right 1039470436 8:37810003-37810025 CCCGCAGCTGGTCTGAATTTAGG No data
1039470432_1039470438 5 Left 1039470432 8:37809983-37810005 CCTGCACACTGACACCAGTGCCC 0: 1
1: 0
2: 2
3: 20
4: 253
Right 1039470438 8:37810011-37810033 TGGTCTGAATTTAGGTGTGTTGG No data
1039470432_1039470439 24 Left 1039470432 8:37809983-37810005 CCTGCACACTGACACCAGTGCCC 0: 1
1: 0
2: 2
3: 20
4: 253
Right 1039470439 8:37810030-37810052 TTGGCAGAGAATAGAGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039470432 Original CRISPR GGGCACTGGTGTCAGTGTGC AGG (reversed) Intronic
900089277 1:912657-912679 GGGGACTGGTGTCTGCGTGAAGG + Intergenic
900089689 1:914489-914511 GGACACTGGGGGCAGTGAGCTGG - Intergenic
902437896 1:16409825-16409847 GGGCACCGGGGTCAGGGTCCTGG + Exonic
905892950 1:41528502-41528524 GGGCAGGGGTGTGAGTGTGAAGG - Intronic
905892992 1:41528666-41528688 GGGCAGGGGTGTGAGTGTGAAGG - Intronic
905893056 1:41529002-41529024 GGTCAGTGGTGTGAGTGTGAGGG - Intronic
906580437 1:46931010-46931032 GGGCTGTGGCTTCAGTGTGCTGG - Intronic
906603288 1:47147878-47147900 GGGCTGTGGCTTCAGTGTGCAGG + Intronic
907385369 1:54122287-54122309 GGGCACAGGTGTGAGGGGGCGGG - Intergenic
908055749 1:60284951-60284973 GGGCACTGGTGAGTGTGGGCAGG + Intergenic
908251073 1:62266290-62266312 AGGCAGTGGTGTGAGTGTGCAGG - Intronic
912380690 1:109246646-109246668 GGGCTCTGGGGTCAGATTGCCGG + Intergenic
914750320 1:150530654-150530676 GGACACTGGAGACAGTGTGAAGG - Intergenic
915140842 1:153767628-153767650 GGGCACTGGGGTCAGGCTGCTGG + Intronic
916392149 1:164342454-164342476 GTGCACTGGTGGCAGTGGGATGG - Intergenic
917121077 1:171645296-171645318 GAGCACTGAGGTCCGTGTGCAGG - Intronic
917437214 1:175033708-175033730 GGCCACTGGCTACAGTGTGCAGG + Intergenic
918139388 1:181707642-181707664 AGAAACTGGTGGCAGTGTGCAGG + Intronic
918684350 1:187396822-187396844 GGGCACTGGAGTGAATGTCCTGG - Intergenic
919661090 1:200248223-200248245 GGGCACTGAAGTCATTGTGATGG + Intergenic
919896708 1:202013540-202013562 GGACACTGGAGTCAGTGGACAGG - Intronic
921188623 1:212690892-212690914 GGGCAATTGTGGCAGTCTGCAGG + Intronic
1062828436 10:588539-588561 GGGCCCTGGTGTCACTTTCCCGG - Intronic
1065530458 10:26664677-26664699 AGGCAGTGGTTTCAGTGAGCCGG + Intergenic
1067095485 10:43296715-43296737 TGGCACTGGTGACAGTGCACTGG + Intergenic
1067203588 10:44195367-44195389 GGGCACTAGTGTGAGTGTCCAGG + Intergenic
1067525926 10:47038539-47038561 GGGAACTGGGGTGAGTGTGGAGG + Intergenic
1069915776 10:71785750-71785772 GGGCACTGGTGGGAGTGGGCTGG + Intronic
1070313114 10:75287917-75287939 GGGTACTGGGGTCAGTCTGCCGG + Intergenic
1071667697 10:87576766-87576788 GGGAACTGGAGTGAGGGTGCTGG - Intergenic
1071947800 10:90667253-90667275 GGGCACTAGAGTCAGTGCCCTGG - Intergenic
1075686940 10:124370989-124371011 TGGCAGGGGTGTCAGTATGCGGG - Intergenic
1075715133 10:124551385-124551407 GGGTGCTGGGGTCAGTGTGAGGG - Intronic
1077045250 11:541846-541868 GGGTACTGGTGTGGGTGTGTGGG - Intronic
1077298755 11:1837804-1837826 GGGCAATGGTGTCTGGGGGCTGG + Intergenic
1077527399 11:3075418-3075440 GGGCACTGGAGTGGGTGAGCAGG + Intergenic
1077882840 11:6364395-6364417 GGGGTGTGGGGTCAGTGTGCAGG + Intergenic
1078019067 11:7640375-7640397 GGGCAAGGGTGTCGGTCTGCAGG + Intronic
1079238016 11:18703250-18703272 TGGCTCTGGTGACACTGTGCCGG + Exonic
1079597957 11:22275483-22275505 GGCCACTGGTGTCAGATTTCTGG + Intronic
1082098927 11:48155533-48155555 GGGTCCTGGTGTCAGGCTGCAGG + Intronic
1083166515 11:60891412-60891434 AGGCACTGGGGGTAGTGTGCAGG - Intronic
1083943458 11:65911280-65911302 GGGCTCTGCTGTCAGTGCCCAGG + Intergenic
1084980202 11:72824871-72824893 GGGCAGTGGTGAGAGAGTGCAGG + Intronic
1086191464 11:84084254-84084276 GGGGACTGCTGTCGCTGTGCTGG + Intronic
1087503650 11:98993260-98993282 GGGCACTGGTGTTAGTTAACAGG + Intergenic
1087791440 11:102410408-102410430 GGGCACTGTAGACAGTGTCCAGG + Intronic
1088507788 11:110542785-110542807 GGGTACTGGTGGCAGTGGGGTGG - Intergenic
1089589649 11:119532222-119532244 GGGCACTGGAGTCAGGGCGCAGG + Intergenic
1089800158 11:121021475-121021497 TGGCAGTGGTGACAGCGTGCTGG + Intergenic
1089812346 11:121142393-121142415 GGGCAGTGGTGCCAGGGTGGAGG + Intronic
1090434390 11:126674805-126674827 AGGGACTGGTGGGAGTGTGCAGG - Intronic
1091359325 11:134962512-134962534 GGGCATTGATGTATGTGTGCAGG - Intergenic
1092914515 12:13177944-13177966 GGGAAAGGGTGTCAGTGTCCTGG + Intergenic
1093881961 12:24414914-24414936 GATCACTGCTGTAAGTGTGCTGG - Intergenic
1095391686 12:41714659-41714681 TTGCTTTGGTGTCAGTGTGCAGG + Intergenic
1097274372 12:57802255-57802277 GGCCGCTGGGGTGAGTGTGCAGG + Exonic
1099665267 12:85620283-85620305 GGACACTGGAGTCAGACTGCTGG + Intergenic
1099743056 12:86666244-86666266 GGGTAATGGTGCCAGAGTGCAGG - Intronic
1100274746 12:93061950-93061972 GTGCACTGGTGGCAGTGCTCAGG + Intergenic
1102146154 12:110656444-110656466 GGGCACTGATGGCAGGGTGGAGG + Intronic
1102493743 12:113305145-113305167 GGGAACTGGTGATAGTGTGTGGG + Intronic
1103851222 12:123934782-123934804 GGGCCCTGGTGTCAGAGAGGAGG - Exonic
1103941313 12:124502814-124502836 GGGCACAGGTGTCTGAGTGTGGG + Intronic
1108473369 13:50789231-50789253 GGACACTGGGGTCAGAGTGTTGG + Intronic
1109618722 13:64872166-64872188 GGGCACTGGTGGTGGTGGGCAGG - Intergenic
1110368783 13:74718188-74718210 TGGCAGTGGTGACAGCGTGCTGG + Intergenic
1111277290 13:85966869-85966891 GGGCACTGGTGTCTGGATGAGGG + Intergenic
1112100076 13:96178800-96178822 GGGCAGTGGTGTCTGTGCCCAGG - Intronic
1113857790 13:113458296-113458318 GAGCCCTGGTGTGTGTGTGCTGG + Intronic
1113943770 13:114032745-114032767 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113943779 13:114032774-114032796 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113943788 13:114032803-114032825 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113943804 13:114032862-114032884 GGGGTGTGGTGTCAGTGTGGGGG - Intronic
1113943827 13:114032951-114032973 GGGGTGTGGTGTCAGTGTGGGGG - Intronic
1113943849 13:114033040-114033062 GGGGTGTGGTGTCAGTGTGGGGG - Intronic
1113943881 13:114033158-114033180 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113943890 13:114033187-114033209 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113943927 13:114033335-114033357 GGGGTGTGGTGTCAGTGTGGGGG - Intronic
1113943948 13:114033424-114033446 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113943957 13:114033453-114033475 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113943966 13:114033482-114033504 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113943975 13:114033511-114033533 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1113944013 13:114033658-114033680 GGGGCGTGGTGTCAGTGTGGGGG - Intronic
1114020031 14:18469793-18469815 GGACCCTCGTGTCAGTGTTCTGG + Intergenic
1114044297 14:18708587-18708609 GGCCACAGGTGGCAGTGTGTAGG - Intergenic
1114048577 14:18899037-18899059 GGCCACAGGTGGCAGTGTGTAGG - Intergenic
1114113934 14:19502609-19502631 GGCCACAGGTGGCAGTGTGTAGG + Intergenic
1114115634 14:19620360-19620382 GGCCACAGGTGGCAGTGTGTAGG + Intergenic
1114593965 14:23895316-23895338 TGGAACTGTTGTCAGTGGGCTGG - Intergenic
1114804983 14:25824725-25824747 GGGCACAGTTAGCAGTGTGCAGG + Intergenic
1115973467 14:38971584-38971606 GGGCACAGGTCTCAGTGAGGAGG - Intergenic
1120953325 14:90061601-90061623 GGACACGGGTGTCAGTCTGCTGG - Intergenic
1122011241 14:98750751-98750773 GGTCACTGGAGTTAGTGTGAAGG - Intergenic
1122506276 14:102233805-102233827 GGGCACTGTGGTCAGTGTTAGGG + Intronic
1122545189 14:102517863-102517885 GGGCTCTGCTGACAGTGTCCTGG - Intergenic
1122878963 14:104681490-104681512 GGGCGCTGGTGCCCGTGTGCCGG - Intergenic
1123137137 14:106038350-106038372 GGGCACAGGAGTCACTGAGCTGG + Intergenic
1124657081 15:31517327-31517349 GGGCTCTGGTCACAGAGTGCAGG - Intronic
1125283479 15:38068677-38068699 GTGGACTGGTGTAAGTTTGCAGG - Intergenic
1125578899 15:40772244-40772266 GGGCTCTGGTTTCTGTGTTCTGG - Exonic
1126546097 15:49876277-49876299 GGTCATTGTGGTCAGTGTGCAGG - Exonic
1129245727 15:74277623-74277645 GGGCTCTGGCGTCAGACTGCAGG + Intronic
1131047284 15:89324118-89324140 TGGCACTATTGTCAGTGAGCAGG + Exonic
1132498625 16:275239-275261 GGGCCCTGGGGTCACTGGGCTGG - Intronic
1132886489 16:2184487-2184509 GGGCACGCGTGTCTGTGTACAGG - Intronic
1134090643 16:11390005-11390027 GGTCACAGGAGTCAGTGTGTCGG + Intronic
1134220394 16:12348938-12348960 GGGCGATGGTGACAGTGTGGAGG - Intronic
1134625156 16:15718146-15718168 GGGCACTGGTGTAAGGGCCCTGG + Intronic
1136666854 16:31819744-31819766 GGGCCCTGGTGACAGCGTCCTGG + Intergenic
1137060943 16:35791354-35791376 GGGCAGTGGTCTCATTGTGGGGG - Intergenic
1138100316 16:54246865-54246887 GGGCATGGGTGACAGTGGGCTGG + Exonic
1138282348 16:55781534-55781556 GGACATAGGTGTCACTGTGCAGG - Intergenic
1138286596 16:55815110-55815132 GGACATAGGTGTCACTGTGCAGG + Intronic
1140973652 16:80038340-80038362 GGTCAGTTTTGTCAGTGTGCTGG + Intergenic
1142165438 16:88584622-88584644 GGTGACTGGGGTCAGTGTGTAGG + Intronic
1143109255 17:4544264-4544286 GGGCACTGTTGGCACTGTGTCGG + Intronic
1146244344 17:31266241-31266263 GGCCACAGGTGGCAGTGTGTAGG + Intronic
1146626320 17:34438145-34438167 GGTGTCTGGGGTCAGTGTGCTGG + Intergenic
1147487160 17:40827521-40827543 GGGCTCTGGGGTCAGACTGCCGG + Intronic
1148667926 17:49388519-49388541 GGGCAGGGGTGCCAGTGTGCTGG + Intronic
1148775155 17:50091083-50091105 AGGCAGAGGTGGCAGTGTGCAGG + Intergenic
1149057611 17:52384221-52384243 GGGAACTGGTGTCACTGACCTGG + Intergenic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1151494269 17:74450081-74450103 GGGCACTGCGGGCAGAGTGCAGG - Intronic
1152422572 17:80202041-80202063 TGGCACTGGAGTCAGTGGGTGGG - Intronic
1152517143 17:80832257-80832279 GGCCCCAGGTGTCAGGGTGCAGG + Intronic
1152594336 17:81230887-81230909 GGGCTCTGGTGTCTGGGAGCGGG - Intronic
1152754465 17:82081462-82081484 GGGCGCAGGTGTCACTGTGGTGG - Intronic
1153492937 18:5668446-5668468 GGGTACAGGTGTCTGTGTGCAGG + Intergenic
1157294509 18:46433120-46433142 GGGCACAAGGGTCAGTGTGGCGG + Intronic
1160335174 18:78032160-78032182 AGGCACACGTGTAAGTGTGCAGG - Intergenic
1160607893 18:80066064-80066086 GGGCCCGGGAGTGAGTGTGCAGG + Intronic
1161031902 19:2061466-2061488 CGGCACTGGAGCCAGTGCGCAGG - Intergenic
1162799234 19:13101874-13101896 GGGCAGTGGGGTCAGTGTTTGGG - Intronic
1162906161 19:13825432-13825454 GGGCACATGTGTGAGTGTGGAGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1165064176 19:33219499-33219521 GAGGACTGGTGCCAGTGTCCTGG - Intronic
925347066 2:3178879-3178901 GGGCACGGGTGTCTGAGTGGTGG - Intergenic
925596984 2:5564583-5564605 GGTGACTGTGGTCAGTGTGCTGG + Intergenic
926146474 2:10399641-10399663 GGCCAATGGTGTGAATGTGCTGG - Intronic
926165308 2:10519194-10519216 GGGCACTGGTGTGTGTGGCCAGG - Intergenic
927558882 2:24054732-24054754 GGTCGCTGATGTCAGTGGGCTGG + Intronic
929511326 2:42568374-42568396 GGGCCCTGGGGTCAGGGTCCTGG - Intronic
930146882 2:48016652-48016674 GGGCCATGGTGGCAGTTTGCGGG - Intergenic
931785058 2:65611065-65611087 GGCCACTGGGGCCAGTGTGGAGG - Intergenic
934576154 2:95402777-95402799 GGTCACTGGTGGCAGTGCTCAGG + Exonic
934857626 2:97738996-97739018 GGGCCAGGGTATCAGTGTGCTGG - Intronic
935144946 2:100389242-100389264 GGGCTCTGGTGTCAAAGTACTGG + Intergenic
935288596 2:101589264-101589286 GGTCAGAGGTGTAAGTGTGCTGG + Intergenic
936664012 2:114574130-114574152 GGACAGTGGTGTCAGTGAGAAGG + Intronic
937204083 2:120224525-120224547 GGGCAGTGCTGTGAGGGTGCGGG - Intergenic
937321012 2:120960782-120960804 GGGCACTGAGGCCAGGGTGCCGG + Intronic
938425944 2:131187544-131187566 GGCCACAGGTGGCAGTGTGTAGG - Intronic
944225634 2:197346272-197346294 TGTCCCTGGTCTCAGTGTGCAGG - Intergenic
946050042 2:216855005-216855027 AGGCACTGGGGTGAGTGGGCCGG - Intergenic
946141646 2:217696116-217696138 TGGTAATGGTGTCAGTGGGCAGG - Intronic
947917613 2:233844276-233844298 TGGCTCTGATTTCAGTGTGCAGG - Exonic
948742587 2:240057376-240057398 GGCCACAGGTGCCAGTGGGCAGG - Intergenic
1169203354 20:3726442-3726464 GGGCAGAGGTGGCAGTGAGCCGG + Intergenic
1172406700 20:34695056-34695078 GGGCACTGGAGCCAGGCTGCAGG + Intergenic
1172986059 20:38990964-38990986 GGGCTATGGTGTCAGACTGCTGG - Intronic
1172993645 20:39054098-39054120 GGGCTCTGGAGTCAGAGGGCTGG - Intergenic
1173897705 20:46563311-46563333 GGGGAGTGGGGTCAGCGTGCAGG + Intronic
1174060597 20:47830131-47830153 GAGCACTGGTGCCAGGGTGTGGG + Intergenic
1174071301 20:47901239-47901261 GAGCACTGGTGCCAGGGTGTGGG - Intergenic
1174099793 20:48118502-48118524 GAGCACTGGTGCCAGGGTGCAGG + Intergenic
1175182996 20:57161616-57161638 GGGCTCTGGAGTCAGTGGGGAGG - Intergenic
1178609610 21:34069401-34069423 GGCCAGTGGTGACAGTGTGAGGG + Intergenic
1179876775 21:44272690-44272712 CGGCACAGGTGGCCGTGTGCGGG + Intergenic
1180444538 22:15400618-15400640 GGACCCTCGTGTCAGTGTTCTGG + Intergenic
1180467115 22:15621698-15621720 GGCCACAGGTGGCAGTGTGTAGG - Intergenic
1181286152 22:21753937-21753959 GGGCACTGGAGGAAGTGTCCCGG - Intergenic
1181327510 22:22061155-22061177 GGGAGGTGGTGTCAGTGAGCTGG - Intergenic
1181338805 22:22162280-22162302 GGGAGATGGTGTCAGTGAGCTGG - Intergenic
1182595186 22:31414044-31414066 GGGCACTGGTGTCAGAGATCAGG - Intronic
1182712111 22:32329654-32329676 GGGCTCTGGTGTGTGTGTGTTGG + Intergenic
1182712116 22:32329677-32329699 GGGCTCTGGTGTGTGTGTGTTGG + Intergenic
1182712146 22:32329830-32329852 GGGCTCTGGTGTGTGTGTGTTGG + Intergenic
1182712151 22:32329853-32329875 GGGCTCTGGTGTGTGTGTGTTGG + Intergenic
1182712168 22:32329942-32329964 GGGCTCTGGTGTGTGTGTGTTGG + Intergenic
1182712182 22:32330008-32330030 GGGCTCTGGTGTCTGTGTGTTGG + Intergenic
1182712376 22:32330967-32330989 GGGCACTGGTGTGTGTGTTGGGG + Intergenic
1183992318 22:41605937-41605959 GTGTACTGATGTCAGAGTGCAGG + Intronic
1184147526 22:42620059-42620081 GGGTCCTGGTGACAGTTTGCTGG - Intronic
1184239859 22:43206394-43206416 GGGCACGCGTGTGTGTGTGCGGG - Intronic
1184389310 22:44194087-44194109 GGGCTCTGGAGTCAGTGGCCTGG + Intronic
950590675 3:13934178-13934200 GGTCACTGGCGTCAGTGGACTGG - Intergenic
950711857 3:14818995-14819017 GGTCACTGGCGTCAGTGGACTGG - Exonic
952198257 3:31098523-31098545 GGACCCTGGGGTCAGTGTCCTGG - Intergenic
952956669 3:38562073-38562095 GGGCCCTGGTGCCAGTGGCCTGG + Intronic
954132159 3:48566415-48566437 GGGCCCAGGGGTCAGGGTGCTGG + Intronic
954327892 3:49873481-49873503 GGGCCCTGGTGCCACTGTGCTGG - Intergenic
954467742 3:50666470-50666492 GGACGCTGGTCTGAGTGTGCAGG + Intergenic
955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG + Intronic
955982455 3:64540667-64540689 AGGCACAGGGGTCAGTGTGGGGG - Intronic
956247684 3:67202774-67202796 GGGCACTCATCTCAGTGCGCAGG - Intergenic
956589936 3:70904092-70904114 GGGCTCTGGGGTCAGATTGCTGG - Intergenic
960986156 3:123282438-123282460 AGTGACTGGTGACAGTGTGCAGG - Exonic
962560097 3:136597003-136597025 AGGCAGTGGTTACAGTGTGCTGG + Intronic
963234131 3:142939001-142939023 GAACACTGGTGACAGAGTGCAGG + Intergenic
967946402 3:194807597-194807619 TGGCTCTGGCGTCACTGTGCTGG - Intergenic
968349327 3:198039745-198039767 CAGAACTGCTGTCAGTGTGCTGG + Intronic
968600165 4:1504980-1505002 GGGCACTGGTGTCACTGTGGGGG + Intergenic
969139434 4:5055700-5055722 GGGCTATGGTGTGAGGGTGCAGG - Intronic
969760106 4:9175409-9175431 GGGCCCTGGTGTCTGACTGCAGG - Exonic
974323328 4:60380929-60380951 TGGCAGTGGAGTCAGTGTCCAGG - Intergenic
975429086 4:74267239-74267261 GTGCATTGGTGTCTGTTTGCAGG + Intronic
975434353 4:74334289-74334311 GGGCACTGGTGTCTGGATGAGGG + Intergenic
976314609 4:83646002-83646024 GGGCAGTCGTGTTAGTGTCCTGG - Intergenic
979813153 4:125064918-125064940 GGGCATTGGTGGCAGTGAGTAGG - Intergenic
981108695 4:140910906-140910928 GAGCCCTGGTGTCAGTGTGTGGG + Intronic
981153233 4:141403098-141403120 GGGGGCTGGTGTCAGTCTACTGG + Intergenic
985577155 5:678739-678761 GGGCACCGGTGTCAGGGCGCAGG + Intronic
985592072 5:770792-770814 GGGCACCGGTGTCAGGGTGCAGG + Intergenic
986638741 5:9850718-9850740 GGGCACACGTGTAAGTATGCCGG + Intergenic
988919540 5:35927601-35927623 GGGGACTGGTCTCAGTGCTCAGG - Intronic
990861693 5:60334651-60334673 GGGCAGTGGCTTGAGTGTGCTGG - Intronic
993501801 5:88674388-88674410 GGGCGCGGGTGTCTGCGTGCCGG + Intergenic
999084505 5:148875050-148875072 GGGCTCTGGAGTCAGGCTGCTGG + Intergenic
999328923 5:150659911-150659933 GACCACCGGTGTCTGTGTGCTGG - Intergenic
1003879076 6:10464036-10464058 GGGCACAGAGGTTAGTGTGCTGG + Intergenic
1004131138 6:12921345-12921367 GGGCACAGGGCTGAGTGTGCAGG + Intronic
1006386232 6:33732504-33732526 GGACTCGGGTGTCAGTGTTCAGG - Intronic
1006466066 6:34195744-34195766 TGGCACTGCTGTGAGGGTGCTGG + Intergenic
1010265240 6:73858384-73858406 GGGCACTGGAGTCACAGTGTGGG - Intergenic
1010270719 6:73914016-73914038 GGGCAACGGTGACAGTGGGCGGG - Intergenic
1013017995 6:106178613-106178635 TGACTCTGGTGGCAGTGTGCAGG - Intergenic
1013087245 6:106866982-106867004 GGGCACTGGTGTCTGGATGAGGG - Intergenic
1016183059 6:141170870-141170892 GGGCACAGGTGAGACTGTGCAGG + Intergenic
1018263141 6:161990086-161990108 TGGCAGTGGTGGCAGTGGGCTGG - Intronic
1019450466 7:1095158-1095180 GAGCACGGATGTCAGTGTGATGG - Intronic
1019541959 7:1555616-1555638 TGGCGCTGGTGTCCGTGTGGGGG - Intronic
1020963384 7:14834513-14834535 GAGCACTCGTGACTGTGTGCTGG - Intronic
1022836607 7:34122545-34122567 CAGGACTGGTGTCTGTGTGCAGG - Intronic
1024300972 7:47887429-47887451 GGGCACTGGTGTCAGGACACTGG - Intronic
1024599763 7:50970095-50970117 GGGCACAGGTGACAGTGGTCAGG + Intergenic
1025015964 7:55439365-55439387 GGTCATTGGAGTCAGTGTGGAGG + Intronic
1025224392 7:57144154-57144176 GTGCATGGGTGTGAGTGTGCAGG - Intergenic
1025234340 7:57223892-57223914 GAGCACTGGTGCCAGGGTGCAGG - Intergenic
1025745274 7:64237341-64237363 GTGCATGGGTGTGAGTGTGCAGG + Intronic
1027230124 7:76267633-76267655 TGGCCCTGGTGTCAGGGTGAGGG + Intronic
1029439088 7:100577464-100577486 GGGCAGTGGCGTCAGTTTGGGGG + Intronic
1029709042 7:102289654-102289676 AGGCACTGGTATGAGTGTCCTGG + Intronic
1034459740 7:151191811-151191833 GGGCACTGATGTCCAGGTGCTGG + Exonic
1038452216 8:27646980-27647002 GGGCAATAGTGTGTGTGTGCGGG - Intronic
1039470432 8:37809983-37810005 GGGCACTGGTGTCAGTGTGCAGG - Intronic
1044277766 8:90322123-90322145 AGGCAGTGGAGTCAGTGGGCAGG + Intergenic
1044538948 8:93389095-93389117 GGGCTCTGGAGTCAGTTAGCTGG - Intergenic
1045551285 8:103174900-103174922 GGGGACTGTTGTCAGATTGCTGG - Intronic
1049573315 8:143379517-143379539 GGGCACCCGTGTCAGGATGCAGG + Intronic
1053527479 9:38844702-38844724 GAGCACTGCTGTCAGAGGGCAGG - Intergenic
1054199703 9:62069131-62069153 GAGCACTGCTGTCAGAGGGCAGG - Intergenic
1054638652 9:67519226-67519248 GAGCACTGCTGTCAGAGGGCAGG + Intergenic
1055781271 9:79824012-79824034 GGGCATTGGTGAGAGTGAGCTGG + Intergenic
1057180533 9:93027289-93027311 AGGCACTGGTGTCAGTTTGTTGG + Intronic
1059506908 9:114807441-114807463 GGGGACGGGTGACAGTGAGCAGG - Intergenic
1059530698 9:115032840-115032862 GGTCATTGGTTTCAGTTTGCAGG + Intronic
1060056573 9:120419064-120419086 GGGCACTGATCTCACTGTGAGGG - Intronic
1060496827 9:124125503-124125525 GGGCAGTGGGGTCTGTGGGCAGG - Intergenic
1061534640 9:131239906-131239928 GGGCACTGGGGTCCGTCTGCTGG - Intergenic
1061987008 9:134135777-134135799 GGCCGCTGGTGTCTGTGTACAGG + Intronic
1062129185 9:134883501-134883523 GGGCAGGGGTCTCAGTGTGGGGG + Intronic
1062519781 9:136952837-136952859 GGGCAGGGGTGGCAGTGGGCAGG - Intronic
1062585463 9:137247505-137247527 GGGCACTGCAGTCTGTGGGCTGG - Intronic
1062685079 9:137808341-137808363 GAGCTCTGGTGGCAGTGAGCTGG + Intronic
1185507338 X:640965-640987 GGGAGCAGGTGTCAGTGTGGTGG - Intronic
1186669325 X:11754114-11754136 GGGCACTGATGGCAGTATTCTGG + Intergenic
1187628299 X:21141533-21141555 CAGCAGTGGTGTCAGTGGGCTGG + Intergenic
1192775475 X:74240232-74240254 GGGCTGTGGTGTCTGTGTGATGG - Intergenic
1194086924 X:89539302-89539324 GCGCACTGCTCCCAGTGTGCAGG - Intergenic
1195668573 X:107451005-107451027 GGGCTGTGGTGTGTGTGTGCAGG - Intergenic
1199824938 X:151489451-151489473 GGCCCCTGGTGCAAGTGTGCAGG - Intergenic
1199997725 X:153036877-153036899 GGGCACTGGTGTAACTGTGATGG - Intergenic
1200074372 X:153543917-153543939 GGGCCCTGGGGCCAGTGCGCGGG + Intronic
1200235459 X:154465867-154465889 GGGCCCTGTTGGCAGTGGGCAGG - Intronic