ID: 1039471088

View in Genome Browser
Species Human (GRCh38)
Location 8:37814275-37814297
Sequence GGCCTGGCTTCCCCTACACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039471085_1039471088 1 Left 1039471085 8:37814251-37814273 CCGAGGCGCAGAGGCTGAGGCTG 0: 1
1: 0
2: 6
3: 58
4: 488
Right 1039471088 8:37814275-37814297 GGCCTGGCTTCCCCTACACTCGG No data
1039471084_1039471088 2 Left 1039471084 8:37814250-37814272 CCCGAGGCGCAGAGGCTGAGGCT 0: 1
1: 0
2: 3
3: 63
4: 669
Right 1039471088 8:37814275-37814297 GGCCTGGCTTCCCCTACACTCGG No data
1039471083_1039471088 3 Left 1039471083 8:37814249-37814271 CCCCGAGGCGCAGAGGCTGAGGC 0: 1
1: 0
2: 1
3: 37
4: 321
Right 1039471088 8:37814275-37814297 GGCCTGGCTTCCCCTACACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039471088 Original CRISPR GGCCTGGCTTCCCCTACACT CGG Intronic
No off target data available for this crispr