ID: 1039473534

View in Genome Browser
Species Human (GRCh38)
Location 8:37827694-37827716
Sequence CCTCATCTGAAGGAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039473526_1039473534 6 Left 1039473526 8:37827665-37827687 CCTTGAACAAGCTGTCACTTCCC 0: 1
1: 0
2: 1
3: 36
4: 403
Right 1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG No data
1039473524_1039473534 30 Left 1039473524 8:37827641-37827663 CCATGGAGAAGACAGGACTGAGG 0: 1
1: 0
2: 6
3: 34
4: 433
Right 1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039473534 Original CRISPR CCTCATCTGAAGGAGGAGGC TGG Intronic
No off target data available for this crispr