ID: 1039475753

View in Genome Browser
Species Human (GRCh38)
Location 8:37838655-37838677
Sequence GCAGGCCTGCTGCTGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039475739_1039475753 27 Left 1039475739 8:37838605-37838627 CCTGGTCACCCCCTCCCTCGTGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG No data
1039475746_1039475753 13 Left 1039475746 8:37838619-37838641 CCCTCGTGGCACGTGGTACTGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG No data
1039475743_1039475753 18 Left 1039475743 8:37838614-37838636 CCCCTCCCTCGTGGCACGTGGTA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG No data
1039475749_1039475753 -8 Left 1039475749 8:37838640-37838662 CCACTCTCCAGTCCTGCAGGCCT 0: 1
1: 0
2: 1
3: 51
4: 452
Right 1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG No data
1039475742_1039475753 19 Left 1039475742 8:37838613-37838635 CCCCCTCCCTCGTGGCACGTGGT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG No data
1039475744_1039475753 17 Left 1039475744 8:37838615-37838637 CCCTCCCTCGTGGCACGTGGTAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG No data
1039475747_1039475753 12 Left 1039475747 8:37838620-37838642 CCTCGTGGCACGTGGTACTGCCA 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG No data
1039475745_1039475753 16 Left 1039475745 8:37838616-37838638 CCTCCCTCGTGGCACGTGGTACT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039475753 Original CRISPR GCAGGCCTGCTGCTGGTCAC AGG Intronic
No off target data available for this crispr