ID: 1039477192

View in Genome Browser
Species Human (GRCh38)
Location 8:37845381-37845403
Sequence GCTTGTTAGGGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039477192 Original CRISPR GCTTGTTAGGGGAAGGTGGA GGG Intronic
900575420 1:3380113-3380135 GCATGTTAGGAGAGGGTGCACGG - Intronic
901860293 1:12070025-12070047 GGTGGTTAGGAGAAGGTGGCAGG + Intronic
902433533 1:16382052-16382074 GCTTGATAGGGGAGAGTGGTAGG + Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903892527 1:26579319-26579341 GCTTGTTAGGCTGAGGTGGGAGG - Intergenic
904002579 1:27347403-27347425 GCTTGCTGGAGGAAGGGGGAGGG - Exonic
904267933 1:29328508-29328530 GGTTGTTAGGGGATTGTGCAAGG - Intergenic
906130986 1:43455811-43455833 GCATATTATGTGAAGGTGGAAGG - Intergenic
906141295 1:43535298-43535320 CCATGTTTGGGGTAGGTGGAAGG + Intronic
906313389 1:44769781-44769803 CCTTGGTAGGGTAAGGTGGGAGG + Intergenic
906402690 1:45517109-45517131 GCTTGTTAGGCAAAGCTGGAAGG - Intronic
906544203 1:46609967-46609989 CCTTGGTAGGGGAGGGTGGTAGG + Intronic
907295210 1:53447070-53447092 GATTGGTAGAGGAAAGTGGAGGG - Intergenic
907650913 1:56294035-56294057 GGTTGTCAGTGGAAGGTGGTAGG - Intergenic
907809880 1:57858603-57858625 GCTTGTTAGGGGGTGGCTGAGGG + Intronic
908462384 1:64357699-64357721 GCCTGTTAGGGGCTGGTAGAGGG + Intergenic
909649170 1:77954067-77954089 GCTTGGGAGGCTAAGGTGGAAGG - Intronic
911557759 1:99366083-99366105 GCGTATTAGGTGAAGGTGAATGG - Intergenic
911684508 1:100759404-100759426 GTTTGTTATGGGAAGGAAGAAGG + Intergenic
911741993 1:101396071-101396093 ACTTGTGAGGGGGAGGTGGGAGG + Intergenic
913352055 1:117872679-117872701 GCCTGTTGGGGGAGGGTGGGGGG + Intronic
914924004 1:151868058-151868080 GCTTGCTAGGGGAATGAGGGTGG - Intergenic
915964833 1:160297502-160297524 GGTTCTTGGGGGAAGGAGGAAGG - Intronic
916382793 1:164231620-164231642 GCTGGTAAGGGGAGGGTGGTGGG + Intergenic
917613311 1:176711863-176711885 GCCAGTTAGGGGACGGTGGTTGG - Exonic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
920414551 1:205790036-205790058 GCTTGGTAAGGAGAGGTGGAGGG + Exonic
921060522 1:211580162-211580184 GGTTGCTATGGGGAGGTGGAGGG + Intergenic
922555443 1:226528754-226528776 GCATGGTAGGGGCAGGTGGCAGG - Intergenic
922613126 1:226944456-226944478 TCTTGTTGCGGGAAGGAGGAGGG + Intronic
923029250 1:230234260-230234282 GCTTCTGAAGGGAAGTTGGAGGG + Intronic
923544126 1:234911988-234912010 GCTTGTGTGTGGAAGGCGGAGGG + Intergenic
1063526842 10:6795100-6795122 GCTTGATGGGGGAGGGTGGGAGG + Intergenic
1063558562 10:7104379-7104401 ACTTGATGGGGGAAGGTGGGAGG - Intergenic
1063634921 10:7772995-7773017 TCTTGTAAGAGCAAGGTGGAGGG + Intronic
1063752262 10:8963613-8963635 ACTTGATGGGGGAAGGTGGGAGG + Intergenic
1064313227 10:14230778-14230800 GCTTGAAGGTGGAAGGTGGAAGG - Intronic
1065232782 10:23615603-23615625 GCTTGAGTGGGGAGGGTGGAAGG - Intergenic
1066522304 10:36235329-36235351 GCTTGCCAGGGGCAGGGGGAGGG + Intergenic
1070700652 10:78599379-78599401 GCTAGCTGGGTGAAGGTGGAGGG + Intergenic
1071004637 10:80868431-80868453 GCTTGGTAGGTTAGGGTGGAGGG + Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072513196 10:96149569-96149591 GCTTGTGGGAGGAAGGAGGAAGG - Intronic
1073128440 10:101168094-101168116 GCTTGTTGGGGGTGGGAGGAGGG + Intergenic
1073609028 10:104925058-104925080 GCCTGTCAGGGGAAAGGGGAGGG - Intronic
1073651948 10:105370415-105370437 GCTTGTTTGGGGGAGGAGTAAGG - Intergenic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1073948274 10:108777533-108777555 GCTTGTCAGGGGACAGTAGAGGG - Intergenic
1074556542 10:114496491-114496513 GCCTGTTGGGGGAGGGTGGCGGG + Intronic
1074960995 10:118445819-118445841 GGATGATAGGGGAGGGTGGATGG - Intergenic
1075956003 10:126523739-126523761 GGTTGTTAGGGGCTGGGGGAAGG - Intronic
1076544594 10:131236863-131236885 GCTTGTGTGGGGACAGTGGATGG - Intronic
1077384853 11:2263950-2263972 GCTAGACAGGGCAAGGTGGACGG - Intergenic
1077697846 11:4411499-4411521 GCTAGTTGGGGGAAAGAGGATGG - Intergenic
1077942821 11:6861748-6861770 ACTTGAGAGTGGAAGGTGGAAGG + Intergenic
1078307507 11:10205000-10205022 GCCTGTTGGGGGGAGGTGGGAGG + Intronic
1078579392 11:12526854-12526876 TCTTGTTGGGGGAGGGAGGAAGG + Intronic
1078835276 11:15022281-15022303 GCCTGTTAGGGGGAGGTGAAGGG + Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079111217 11:17606214-17606236 GCTTCTTAGGGGTAATTGGAAGG - Intronic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1081028057 11:38040384-38040406 GCTTGGGAGGGCAAGGTGGGAGG - Intergenic
1081296183 11:41392536-41392558 GTTTGTTTGGGGGAGGTGGTGGG - Intronic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081781386 11:45715524-45715546 GTTTGCTGGGGGAAGGTGGGAGG - Intergenic
1082021435 11:47536887-47536909 GCTTGAAAGGGGAAGTAGGAAGG + Intronic
1082920919 11:58492914-58492936 GGTTGTTAGGGGCAGGGGGAGGG + Intergenic
1083129476 11:60611003-60611025 ACTTAGGAGGGGAAGGTGGAAGG + Intergenic
1083172447 11:60930991-60931013 GCTTTTTGGGGGAATGTGAACGG - Intronic
1083281056 11:61627578-61627600 GCTTGTTAGAAGAATGAGGATGG - Intergenic
1084939292 11:72603779-72603801 AGTTGTTAGGGGAAGGTGAAAGG + Intronic
1091137040 11:133201125-133201147 ACTTGAGAGTGGAAGGTGGAAGG + Intronic
1091303270 11:134521476-134521498 GCCTGGGTGGGGAAGGTGGATGG - Intergenic
1091309495 11:134562478-134562500 GCTTGTTCTGGGAGGGGGGATGG + Intergenic
1091358770 11:134958105-134958127 GCTGGTCAGGGTTAGGTGGAAGG - Intergenic
1091937341 12:4444317-4444339 GCTTTCTAGGAGAAGGGGGATGG - Intronic
1093302621 12:17474386-17474408 GCTTGTTAGGAAGTGGTGGAGGG - Intergenic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1096362646 12:51001381-51001403 ACTTGATGGGGGAGGGTGGAAGG + Intronic
1096740790 12:53692679-53692701 GCTTGGAAGGCTAAGGTGGAAGG - Intergenic
1096793045 12:54056992-54057014 GTTTGTTAGGAGAAGGTGGGAGG + Intergenic
1097019068 12:56007448-56007470 AGTTGTTAGGGGGAGGGGGACGG + Intergenic
1098069323 12:66655150-66655172 GCCTCTTGGGGGAACGTGGAGGG - Intronic
1099194586 12:79600588-79600610 ACTTGGTAGGCTAAGGTGGAAGG - Intronic
1099343198 12:81465035-81465057 GCTGGTTAGGAGAAGCTGCATGG + Intronic
1099935433 12:89119356-89119378 GTTTGTTGGGGGACGGGGGAAGG - Intergenic
1100364788 12:93910022-93910044 GCTTGTTCAGGGAAGTGGGAAGG + Intergenic
1101111741 12:101493002-101493024 GATTGCTAGGGGCAGGGGGAAGG - Intergenic
1102129589 12:110516116-110516138 ACTTGGTAGGCTAAGGTGGAAGG + Intronic
1102242435 12:111333273-111333295 GCTTGGGAGGCTAAGGTGGAAGG + Intronic
1102247583 12:111365059-111365081 ACTCCTTGGGGGAAGGTGGATGG - Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103663245 12:122539209-122539231 GCTTGTTAAGGGAGGCAGGAAGG + Intronic
1104012738 12:124943441-124943463 GCTGCTTCGGGGAAGGTGGAAGG + Intergenic
1104040388 12:125126369-125126391 GCTTCCTTGGGGAAGGGGGACGG - Intronic
1104517051 12:129437323-129437345 GCTGTTTGGGGGAAGGTGCAAGG - Intronic
1106253842 13:28004001-28004023 GCCTGTTAGGGATAGGTGGAGGG + Exonic
1108055675 13:46482684-46482706 GCTTGGAAGGCTAAGGTGGAAGG + Intergenic
1108948185 13:56050415-56050437 GCTAATTAGTGGAAGGTTGAAGG - Intergenic
1108954076 13:56129265-56129287 GCTTTTTTGGGGGAGGTGGGTGG + Intergenic
1109212014 13:59545839-59545861 GCTTTTTAGGGGCTGGTGTAGGG + Intergenic
1109227532 13:59714424-59714446 ACTTGGGAGGTGAAGGTGGAAGG + Intronic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110994582 13:82090599-82090621 GGTGGGGAGGGGAAGGTGGAGGG - Intergenic
1111393931 13:87637871-87637893 GATTCTTAGGGGAAGCTAGAAGG + Intergenic
1111591243 13:90350117-90350139 GCTTGGGAGGCCAAGGTGGATGG + Intergenic
1112342855 13:98566704-98566726 GCTTGCTGTGGGTAGGTGGAAGG - Intronic
1113243577 13:108368169-108368191 GCTTGATAGGAGAAGGTGGGAGG + Intergenic
1115917362 14:38330924-38330946 GCCTGTTAGGGCAGGGTGGCGGG + Intergenic
1116634993 14:47383196-47383218 GCCTGTCAGGGGATGGGGGAGGG + Intronic
1116651082 14:47593718-47593740 GCCTGTTGGGGGATGGGGGAGGG + Intronic
1117004445 14:51404921-51404943 ACATGTTGGGGGAGGGTGGAAGG - Intergenic
1117344657 14:54820295-54820317 GCTTGGTAAGGGAAAGGGGAGGG - Intergenic
1118743899 14:68760345-68760367 GCTTAGTATGGGAAGGTGGGAGG + Intergenic
1119682963 14:76606668-76606690 GGTTGCTAGGGGAAGGGAGATGG - Intergenic
1121258514 14:92549423-92549445 GCCTATTAGGGGTAGGGGGAAGG - Intronic
1121290968 14:92774791-92774813 GCTCGTTAGGGCAAGTGGGATGG - Intergenic
1121464707 14:94107988-94108010 GCCTGTTGGGGGAAGGGGGCTGG - Intronic
1121719544 14:96099557-96099579 ACTTGTTGGGGGAAGGGGGGAGG + Intergenic
1121947076 14:98133390-98133412 GCTTGTTAGGGGAGTGTCGGAGG - Intergenic
1122728551 14:103777589-103777611 GCATGTGAAGGGCAGGTGGAGGG + Intronic
1124006706 15:25800575-25800597 GCTTCTTCCGGGAAGGTGCACGG - Intronic
1124531395 15:30510840-30510862 TCTTGTTGGGGGAGGGTGGGAGG - Intergenic
1124767260 15:32496856-32496878 TCTTGTTGGGGGAGGGTGGGAGG + Intergenic
1125047719 15:35261722-35261744 ACTTGAGAGGCGAAGGTGGAAGG + Intronic
1126223763 15:46245482-46245504 GCTTGATGGGGGAGGGTGGGAGG - Intergenic
1127058524 15:55157521-55157543 ACTTGATGGGGGAGGGTGGAAGG + Intergenic
1127094253 15:55497108-55497130 TCTTAATAGGGGAAGGGGGAGGG - Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1130450531 15:84047067-84047089 GCCTGTCAGGGGAAGGCGGTGGG - Intergenic
1130671345 15:85915651-85915673 GCCTGTCAGGAGAGGGTGGATGG + Intergenic
1130821925 15:87505078-87505100 GCTTCATAGGTGAAGATGGATGG + Intergenic
1131256621 15:90867076-90867098 GCTTGCTTGGGGAAGGGGGCAGG - Intergenic
1131733000 15:95301763-95301785 GCTTGGAAGGGTAAGGGGGATGG + Intergenic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133464746 16:6018983-6019005 GCTGGCGAGGGGAAGGGGGAGGG + Intergenic
1133553349 16:6881023-6881045 GCATAGGAGGGGAAGGTGGAGGG - Intronic
1136246197 16:28977649-28977671 GCTTGTTTTGGCTAGGTGGAAGG + Intronic
1136672133 16:31867869-31867891 GCCTGTTGGGGGATGGGGGAGGG + Intergenic
1137023880 16:35454813-35454835 ACTGGTTTGGGGAAGATGGAGGG - Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1139206874 16:65037602-65037624 GGTTGTTAGGGGAGAGAGGAGGG - Intronic
1139212940 16:65098607-65098629 ACTTGTGAGGCCAAGGTGGAAGG - Intronic
1140219677 16:73034549-73034571 GCTAGTTTGGGGCAGGAGGAAGG - Intronic
1141804935 16:86336214-86336236 GCTTTTCAGGGAAGGGTGGACGG + Intergenic
1141949009 16:87328816-87328838 GCTTGATTGGGGAAGGTGGCAGG - Exonic
1143149128 17:4796461-4796483 GCTTCGTAGTGGGAGGTGGAGGG + Intronic
1143488169 17:7266867-7266889 GCTGGATAGAGGAAGGTGGGTGG - Intergenic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144393353 17:14817820-14817842 ACTTGAGAGTGGAAGGTGGAAGG - Intergenic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147217674 17:38910456-38910478 GCTTGGCAGGGGGCGGTGGAGGG - Intronic
1147400173 17:40176232-40176254 GCTTGAAAGGGGAAAGTGGCTGG - Intergenic
1148388197 17:47251748-47251770 GCAGGTTTGGGGAAGGTGGAGGG - Intergenic
1148842038 17:50505163-50505185 GATTGTTAGGGGATGGGGGTCGG + Intergenic
1149811696 17:59680505-59680527 GCTTCCTAGGGGAAGGTTGTGGG + Intronic
1150206282 17:63411013-63411035 GCTTCTTAGAGGCAGGAGGATGG + Intronic
1150327050 17:64265542-64265564 GCTTGGTAGGGAAAGGAGGTTGG - Intergenic
1150370730 17:64635508-64635530 GGTTGCTAGGGGATGGGGGAGGG - Intronic
1151454552 17:74218169-74218191 GCTGGTTAGGGGGAGGGGGGTGG + Intronic
1151610831 17:75173581-75173603 ACTTCTTAGGGTGAGGTGGAAGG - Intergenic
1152112046 17:78361896-78361918 GCTTGGGAGGCCAAGGTGGAAGG + Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153004936 18:489804-489826 GGTTGTTAGGGGAAGGTAAAAGG + Intronic
1154183116 18:12154964-12154986 GCTTGAGAGTGGAAGGTGGGAGG + Intergenic
1154496196 18:14963134-14963156 GCTGGTCAGGGTTAGGTGGAAGG + Intergenic
1155103004 18:22632316-22632338 ATTTGCTAGGGAAAGGTGGAAGG - Intergenic
1156221173 18:35053781-35053803 ACTTGAGAGGGGAAGGTAGAAGG + Intronic
1157018399 18:43747349-43747371 ACTTGACAGGGGAAGGTGGGAGG + Intergenic
1157144072 18:45143289-45143311 GCTTATTAGGGGCAGGTGCCAGG - Intergenic
1157703771 18:49783278-49783300 GGTTGTCAGGGGATGGGGGATGG + Exonic
1159492746 18:69159567-69159589 TGTTTTTAGGGGAAGGAGGAGGG - Intergenic
1160762269 19:791679-791701 GCCTCTTAGGGGACGGGGGAGGG + Intergenic
1163043915 19:14624913-14624935 GCCTGTTAGGGGACGTTGGAGGG + Intronic
1163490977 19:17617031-17617053 ACTTGGTGGGGGAGGGTGGACGG - Intronic
1165149888 19:33754031-33754053 GGTTGTTGGGGGATGGTGGGGGG - Intronic
1165231154 19:34387812-34387834 GCTTGTTAGGTGAAGTGGGTGGG + Intronic
1165658495 19:37554140-37554162 GCTTGAGAGTGGAGGGTGGAAGG - Intronic
1166354280 19:42217729-42217751 GCGAGTTGGGGGAAGGAGGAGGG - Intronic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
1167841545 19:52125689-52125711 GCTTATTAGGGCAAGGTCAAGGG - Intronic
1167999535 19:53433403-53433425 TCTTGTTCTGGGAAGGTGGGGGG + Intronic
926238323 2:11066811-11066833 GCCTGTTATGGGATGGGGGAAGG - Intergenic
926695503 2:15767727-15767749 CCATGTTAGGGGAAGGAGGGTGG - Intergenic
927318167 2:21710354-21710376 GCCAGGTAGTGGAAGGTGGAAGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927684072 2:25158718-25158740 GCTTGGAAGGGGAAGGTGACTGG - Exonic
928278950 2:29927240-29927262 GCCTGTTGGGGGATGGGGGATGG + Intergenic
928480498 2:31678242-31678264 GCCTGTTGGGGGATGGGGGATGG - Intergenic
928898636 2:36293771-36293793 GCTAGTTAGGAGGAGGGGGAGGG - Intergenic
929349884 2:40937721-40937743 ACTGGTTGGGGAAAGGTGGATGG + Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
929994560 2:46817274-46817296 TCTTGGTAGAGGAAGCTGGAGGG - Exonic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930570333 2:53077920-53077942 GCTTGTCAGGGGTTGGGGGACGG - Intergenic
931732462 2:65165390-65165412 GGTAGTTGGGGGAAGGTGGATGG + Intergenic
932224786 2:70031005-70031027 GCTTATGAGGGGAAGGTACAGGG + Intergenic
932883216 2:75523607-75523629 GGTTGGGAGGGGAAGGTTGATGG - Intronic
937044521 2:118844089-118844111 GCCGGTTAGAGGAATGTGGAAGG - Intronic
938177400 2:129146651-129146673 GCTTGTGGGGGGAAGAGGGAAGG - Intergenic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
940436753 2:153665483-153665505 GCTAGATAGGGGGAGGTGGTGGG - Intergenic
941270549 2:163422006-163422028 TATTGTTAAGGGAAGGTTGAGGG + Intergenic
941624790 2:167819701-167819723 AATTGTTAGTGGAAGGTGGCGGG + Intergenic
941673632 2:168321300-168321322 GCAAGTTATGGGAAGGTGGGGGG - Intergenic
943367254 2:186977863-186977885 GGTTGGGAGGGGAAGCTGGAGGG + Intergenic
944489311 2:200241817-200241839 CATTGCTAGGGGAAGGTGCAGGG - Intergenic
945891640 2:215436349-215436371 ACTTTTTAGGGGATGGGGGAAGG + Intergenic
947080344 2:226388933-226388955 GGGTTTTAGAGGAAGGTGGAAGG + Intergenic
948893438 2:240917692-240917714 GCTTGCCAGGGGAAGCTGGGAGG - Intergenic
949027489 2:241773418-241773440 GAGGGTTAGGGGCAGGTGGAGGG + Intergenic
1170364049 20:15580796-15580818 TCTTCTTAGGGGAAAGGGGAGGG + Intronic
1171171136 20:23016314-23016336 TCTTGGTGGGGGTAGGTGGAGGG - Intergenic
1172459015 20:35101209-35101231 GCTGGCAAGGGGAAGGAGGAAGG - Intergenic
1173334399 20:42101119-42101141 GCTGGGGAGGGGAAGCTGGAAGG + Intronic
1173825040 20:46042829-46042851 GCTGGTTTGGGGTGGGTGGAGGG + Intronic
1173861900 20:46289240-46289262 GGTTGTAAGGGAAAGGTGCATGG - Intronic
1174053539 20:47783794-47783816 GCTTGAAAGGCGAAGGTGGTGGG - Intronic
1174655251 20:52166561-52166583 GCTTGTGAGGCTAAGGTGGGAGG - Intronic
1175542549 20:59756813-59756835 GCTTGGTGGGGGGAGGGGGAGGG - Intronic
1176303844 21:5113377-5113399 GCCTGGCCGGGGAAGGTGGAGGG + Intergenic
1176521088 21:7825010-7825032 GCTTGTCGGGGAAAGGTGGGTGG + Intronic
1177024029 21:15899275-15899297 ACTTGAGAGGGGAGGGTGGAAGG - Intergenic
1178655108 21:34455022-34455044 GCTTGTCGGGGAAAGGTGGGTGG + Intergenic
1178811414 21:35885753-35885775 GCCTGTTGGGGGTAGGGGGAGGG + Intronic
1178842530 21:36149233-36149255 ACTTGGTAGGCTAAGGTGGAAGG + Intergenic
1179093707 21:38292470-38292492 GCTTTTTAGGGAAAGTTGTAAGG - Intronic
1179604470 21:42504919-42504941 GATTGGTTGGGGAAGGGGGAAGG - Intronic
1179853186 21:44148573-44148595 GCCTGGCCGGGGAAGGTGGAGGG - Intergenic
1179953453 21:44724423-44724445 GCCTCTTTGGGGAAGGTGGTGGG + Intergenic
1180988085 22:19917358-19917380 GCTTGTGAGGTCCAGGTGGAGGG + Intronic
1182151791 22:28032734-28032756 GCCTTTTAGGGGGAGGGGGAGGG - Intronic
1182236197 22:28878812-28878834 ACTTGTGAGGGTAAGGTGGGAGG - Intergenic
1183160785 22:36111572-36111594 GCTTGCTGGGGGATGGTGGCAGG - Intergenic
1183363265 22:37393995-37394017 GCATGTTAGGTGGAGGTGGCAGG - Intronic
1184729856 22:46366171-46366193 GGTTGTTGGGGGAAGGTGCAGGG + Intronic
1184777826 22:46632146-46632168 GCTTGGGAGGGGAAGGTTGGAGG + Intronic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950332573 3:12168238-12168260 GCTTGATACGGGTAGATGGAGGG + Intronic
950795261 3:15505435-15505457 TCTTGTCAGGGAAAGGGGGATGG - Intronic
951537874 3:23756139-23756161 GCTTGGGAGGGGCAGGTGGCAGG - Intergenic
951927941 3:27930251-27930273 GGTTGTTAGGGGTAGGAGAAGGG + Intergenic
952490711 3:33870010-33870032 GCTGATGAGGGGAAGGGGGATGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
953184438 3:40625143-40625165 GCCTGTGTGGGGAAGGTGGGAGG + Intergenic
953876520 3:46669859-46669881 GCCTGTGAGGGGAGGGTTGAGGG - Exonic
954263108 3:49454137-49454159 GCTTGGGAGGGTAAGGTGGGAGG + Intergenic
954298026 3:49684950-49684972 GCTTGCCTGGGGAAGGGGGAAGG + Intronic
956951400 3:74287735-74287757 GCTGGTGATGGGAGGGTGGAAGG + Intronic
958129183 3:89395803-89395825 GGATGGGAGGGGAAGGTGGAAGG - Intronic
958854437 3:99367637-99367659 ACTTGGTGGGGGAGGGTGGAAGG - Intergenic
959298761 3:104573288-104573310 GCCTGTCAGGGGAGTGTGGAAGG - Intergenic
959565742 3:107831364-107831386 GCTTGTTAGACGCAGGTGGCCGG + Intergenic
959599778 3:108168643-108168665 GCCTGTTGGGGGATGGGGGATGG - Intronic
959911559 3:111769242-111769264 GCTTGATAAGGGAACTTGGAGGG - Intronic
960091692 3:113646470-113646492 AGTTGCTGGGGGAAGGTGGAAGG - Intergenic
960720106 3:120617266-120617288 GCTTGTCTGGATAAGGTGGAGGG + Intergenic
960854005 3:122084579-122084601 GCTTGGCAGGGATAGGTGGAAGG + Intronic
961037780 3:123654661-123654683 GGGGGTTAGGAGAAGGTGGAGGG - Intronic
961145960 3:124593579-124593601 GCAGGTTAGGGGAGGGTGGAGGG - Intronic
962158224 3:132971619-132971641 GGTTGCTAGGGGATGGGGGAGGG + Intergenic
962325779 3:134430966-134430988 ACTTGTTAAGGGAGGCTGGAGGG + Intergenic
963824975 3:149943687-149943709 GGTTGCTAGGGGATGGGGGAAGG - Intronic
964030105 3:152128415-152128437 GCTTGTTAGTGGTATGAGGAGGG + Intergenic
964230696 3:154463789-154463811 ACTTATGATGGGAAGGTGGAAGG - Intergenic
964284139 3:155099084-155099106 CCATGTTGGGGCAAGGTGGAGGG + Intronic
965033619 3:163405862-163405884 ACTTTTTAGGGGAAAGTGAATGG + Intergenic
967095902 3:186176948-186176970 GCTTGTTGGGAGAAGGAGCAGGG + Intronic
967900039 3:194440505-194440527 GCTTGTTGGGGGATGGGGGATGG - Intronic
967982723 3:195075511-195075533 GCTTGTTTTGGGTAGGTGGGAGG - Intronic
968687114 4:1968414-1968436 GCTTGTTCTGTGAGGGTGGAGGG + Intronic
968741019 4:2331820-2331842 GATTGGCAGGGGGAGGTGGAAGG - Intronic
969232816 4:5843339-5843361 GCTACAAAGGGGAAGGTGGATGG - Intronic
969430586 4:7151543-7151565 GGTTATGAGGGGCAGGTGGAGGG + Intergenic
969495787 4:7525498-7525520 GCTGCTTGGGGGAAGGTGGAGGG - Intronic
970286858 4:14527412-14527434 GCCTGTTTGGGGAGGGTGGCAGG + Intergenic
970776455 4:19680039-19680061 GCTTGTTGGGGGTGGGGGGAAGG - Intergenic
973705448 4:53575999-53576021 GCTGGTGGGGGGAAGATGGAGGG - Intronic
974011509 4:56611858-56611880 GCTTGTGTGGGGAAGTTGAAGGG - Intergenic
976105798 4:81615656-81615678 GCTTTATAAGTGAAGGTGGATGG + Intronic
976385701 4:84455475-84455497 GTTTGTGATGGGAAGGTGTAAGG - Intergenic
977058778 4:92229310-92229332 GCTTGAGGGGGGAAGGTGGGAGG + Intergenic
981749867 4:148082873-148082895 GCTTGGTGGGGGAAGGGGGGAGG + Intronic
981974908 4:150714849-150714871 GCTTGTTAGGTGAATGTGGATGG - Intronic
983520992 4:168708939-168708961 GTTTGTTGTGGAAAGGTGGAGGG + Intronic
984201058 4:176721729-176721751 GCTTATTTGGGCAAGGTGGTAGG + Intronic
985277556 4:188252617-188252639 GCTTGTGGGGGGCGGGTGGAGGG + Intergenic
986428671 5:7660028-7660050 GCTTGAGAGGAGAAGGTGGGAGG + Intronic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
987792143 5:22581555-22581577 GCTTGCTAGGGCAATGTGGAAGG + Intronic
989583028 5:43051271-43051293 GCTTGGAAGGTGGAGGTGGAAGG + Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
991050388 5:62266649-62266671 CCTTGGCAGAGGAAGGTGGACGG + Intergenic
992853925 5:80840743-80840765 GCCTGTTAGGGGTAGGGGGCTGG - Intronic
992863771 5:80937898-80937920 GCTTGATGGGGGAATGTGGATGG + Intergenic
993242627 5:85410492-85410514 GCTTGACAGTGGAGGGTGGAAGG - Intergenic
997517341 5:134499910-134499932 GCCTGTCGGGGGATGGTGGAGGG - Intergenic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998335530 5:141368566-141368588 GCTTCTTAGGGTAAGGTGTTTGG + Intronic
999229465 5:150053088-150053110 TCTTGTTGGGGGAAGAGGGAGGG - Intronic
1001334024 5:170783087-170783109 GCAGGATGGGGGAAGGTGGAGGG + Intronic
1001519973 5:172384518-172384540 GGTTGCTGGGGGAGGGTGGAAGG - Intronic
1002707456 5:181171708-181171730 GCTTGTGAGGCTGAGGTGGAAGG + Intergenic
1002940094 6:1708331-1708353 GCGTGTTTGGAGAAGCTGGAGGG + Intronic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004949222 6:20649717-20649739 GCCTGTTAGGGGGTGGGGGAAGG - Intronic
1005192294 6:23238673-23238695 GTTTGTTGGGTGAAGGTGGATGG + Intergenic
1006084553 6:31586873-31586895 GCTGGTAAGGGGATGATGGAGGG - Intronic
1007345623 6:41227796-41227818 GCTGGTCAGGGAAAGTTGGAGGG - Intergenic
1007590871 6:43020303-43020325 CCTGGTGAGGGTAAGGTGGAGGG + Intronic
1009750675 6:67875250-67875272 GCCTGTCAGAGGAAGGTGGAGGG + Intergenic
1010211011 6:73363025-73363047 TCTTGGGAGGGGAAGGTGGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015887655 6:137935165-137935187 GGTTGCCAGGGGATGGTGGAAGG - Intergenic
1017229832 6:152062189-152062211 AATTGTTAGGGGAAGCGGGAAGG - Intronic
1017310976 6:152977244-152977266 GCTTGTGTGGGGATGGTAGATGG - Intronic
1017419786 6:154261811-154261833 TCTTGTTGGGGGTAGGGGGAAGG - Intronic
1021887944 7:25158257-25158279 ACTTGGGAGGTGAAGGTGGAAGG + Intronic
1022365835 7:29715117-29715139 GCTTGTCAGGGGAGGGTGTGGGG + Intergenic
1022798414 7:33751667-33751689 GCATTTTAGGGGAAGCTGCAAGG + Intergenic
1023689315 7:42769949-42769971 GCTTGGAAGGAGAAGGTAGAGGG - Intergenic
1023983210 7:45081446-45081468 GCTGTTTAGGGGAAGGTGTGTGG + Intronic
1026120869 7:67536145-67536167 GGGTGTTAGGGGAAAGCGGAGGG - Intergenic
1026950041 7:74340842-74340864 GCTTCCTGGGGGAAGGTGGTTGG + Intronic
1027391474 7:77708197-77708219 GCTTGTTTGGGGTAGGGGGTGGG + Intronic
1028039791 7:86037361-86037383 GCTTGTCAGGGGGTGGGGGAAGG - Intergenic
1028740117 7:94264923-94264945 GCTTCTCAGGGGAAATTGGAAGG + Intergenic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1029433277 7:100546264-100546286 CCTTGTTAGGGGGAGGAGGCAGG - Intronic
1029880799 7:103807608-103807630 GCTTGAGAGGGGAGGGTGGAAGG - Intronic
1030185257 7:106755385-106755407 ACTTGATAGGGGAGGGTGGGAGG + Intergenic
1033153557 7:138937185-138937207 GATAGTTACGGGAAGGAGGAGGG - Intronic
1033279603 7:139996352-139996374 GCTTCCCAGGGGAAGGTGGCAGG - Intronic
1033433515 7:141311140-141311162 GCCTGTTGGGGGATGGTGGGAGG + Intronic
1034191014 7:149213544-149213566 GCTTATGAGGGTAAGGAGGATGG + Intronic
1035000486 7:155608879-155608901 TGTTGTGAGGGAAAGGTGGAGGG + Intergenic
1035573621 8:690206-690228 GCTTGTCAGGAACAGGTGGAAGG - Intronic
1036380628 8:8234191-8234213 ACTTGGTAGGGAAACGTGGATGG - Intergenic
1037247336 8:16850177-16850199 GCTTGAAATGGGGAGGTGGAGGG + Intergenic
1037411387 8:18601976-18601998 ACTTGTTAGGGGCTGGTGGGTGG - Intronic
1037525220 8:19717977-19717999 GCTTGATGGCGGATGGTGGATGG - Intronic
1037544904 8:19910176-19910198 GCCTGTCATGGGAGGGTGGAGGG - Intronic
1037563282 8:20094315-20094337 GCTTGTTTGGGGAAGAAGAAGGG + Intergenic
1037748215 8:21663016-21663038 GCTTGGTAGGGGAGGGTGGGGGG - Intergenic
1037885593 8:22594572-22594594 GCTTTGGAGGGGATGGTGGAGGG + Intronic
1038886664 8:31670124-31670146 GCTGGCTGGGGGAAGGTGGTAGG - Intronic
1039047651 8:33464564-33464586 GCTTGGGAGGCCAAGGTGGAAGG + Intronic
1039062874 8:33585700-33585722 GCTTTCTCTGGGAAGGTGGAGGG - Intergenic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1040592290 8:48804870-48804892 GCCTTGTAGGGGAGGGTGGAGGG - Intergenic
1041193408 8:55375878-55375900 GCCTGTTAGGGGAGGGTGTGGGG - Intronic
1041207244 8:55511432-55511454 GCTGGTTGGGGGAAGGCAGAAGG - Intronic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041438940 8:57873351-57873373 GCTTGTTTTGGGAACCTGGAAGG - Intergenic
1044668359 8:94653854-94653876 CCTTGTTAGCTGGAGGTGGAAGG + Intronic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1048053231 8:130839177-130839199 CCTTGTTAGAGAAAGGAGGAGGG - Intronic
1049359557 8:142205810-142205832 GGATGTGAGGGGAAGGGGGAAGG + Intergenic
1050387952 9:5110825-5110847 GTTTGTTCGGGGAAGGTGGGGGG + Intronic
1051411270 9:16791991-16792013 ACTTGGGAGGTGAAGGTGGAGGG + Intronic
1053218266 9:36290656-36290678 GCTTGGGAGGGGAAGGACGAGGG - Intronic
1055086928 9:72323896-72323918 GCTTCTAAGAGGAAGGTAGAAGG - Intergenic
1055960814 9:81818454-81818476 GGTTGTAGGGGGCAGGTGGATGG + Intergenic
1056837525 9:89968966-89968988 TGTGGTTAGGGGCAGGTGGAGGG + Intergenic
1057023674 9:91719742-91719764 ACTTGTAGGGGGAGGGTGGAGGG + Intronic
1057560699 9:96125932-96125954 GCTTGGGAGGCTAAGGTGGAAGG + Intergenic
1057964398 9:99489076-99489098 GCTTGTTCTGGGCAGGGGGAGGG - Intergenic
1058179272 9:101777655-101777677 CATTGTTGGGGGAAGGTGGTGGG - Intergenic
1059326629 9:113507648-113507670 GCTGGTGTGGGGAAGGTGAAGGG + Intronic
1060052273 9:120385905-120385927 GCTTGTAAGTGGGTGGTGGAAGG - Intergenic
1061511908 9:131066854-131066876 GCTGCTCCGGGGAAGGTGGAGGG + Intronic
1061817023 9:133203700-133203722 GCTTGGAAGGGGAAGCTGCATGG + Intergenic
1062047930 9:134432966-134432988 GCGTGATAGGGGCAGGTGGCTGG + Intronic
1062318240 9:135978482-135978504 GCTGCTGAGGGGAAGATGGAGGG - Intergenic
1062318274 9:135978578-135978600 GCTGCTGAGGGGAAGATGGAGGG - Intergenic
1062561041 9:137142033-137142055 GGTCGTTGGGGGTAGGTGGATGG - Exonic
1185950916 X:4432906-4432928 GCTAGTGAGGAGAGGGTGGACGG + Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186471015 X:9822289-9822311 GCAGGTTAGGGGAAGGGGGGAGG + Intronic
1186484249 X:9921622-9921644 GGTTGTTAGGGGATGGGGGAAGG - Intronic
1187138735 X:16573102-16573124 GCCTGTTAGGGGTAGGAGGTGGG + Intergenic
1189526685 X:41830106-41830128 GCTTGGGAGGGTAAGGTGGGAGG - Intronic
1189599660 X:42609563-42609585 GCCTGTCAGGGGATGGGGGAAGG + Intergenic
1192226105 X:69229091-69229113 GCTTGTTTGGGAAATGGGGATGG + Intergenic
1192898208 X:75466885-75466907 GCCTGTTAGGGGTGGGGGGAGGG + Intronic
1193110353 X:77723181-77723203 GCCTGTTAGGGGTTGGGGGAGGG + Intronic
1193653935 X:84174700-84174722 TCTTCATAGGGTAAGGTGGAAGG - Intronic
1194587611 X:95755483-95755505 GCCTGCAGGGGGAAGGTGGATGG - Intergenic
1194633301 X:96313222-96313244 GCTTCATAGGGAAATGTGGAGGG - Intergenic
1196637270 X:118017047-118017069 GATTATTTGGGGAAGGAGGACGG - Intronic
1198120183 X:133584720-133584742 GCTTGGGAGGCCAAGGTGGATGG - Intronic
1198373780 X:136017307-136017329 ACTTGGGAGGGTAAGGTGGAAGG + Intronic
1198580131 X:138054650-138054672 ACTTGTGGGTGGAAGGTGGAAGG + Intergenic
1199270939 X:145881915-145881937 TCTTGAAAGGGGAATGTGGATGG + Intergenic
1199517512 X:148694476-148694498 GCTAGATAGGGGATGGAGGAGGG + Intronic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic