ID: 1039483928

View in Genome Browser
Species Human (GRCh38)
Location 8:37897196-37897218
Sequence ATGCCTATTCATCTCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039483923_1039483928 26 Left 1039483923 8:37897147-37897169 CCCATCCATCCTCACATCAAGGC 0: 1
1: 0
2: 1
3: 17
4: 196
Right 1039483928 8:37897196-37897218 ATGCCTATTCATCTCTGGCCAGG No data
1039483921_1039483928 27 Left 1039483921 8:37897146-37897168 CCCCATCCATCCTCACATCAAGG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1039483928 8:37897196-37897218 ATGCCTATTCATCTCTGGCCAGG No data
1039483924_1039483928 25 Left 1039483924 8:37897148-37897170 CCATCCATCCTCACATCAAGGCT 0: 1
1: 0
2: 2
3: 22
4: 270
Right 1039483928 8:37897196-37897218 ATGCCTATTCATCTCTGGCCAGG No data
1039483926_1039483928 17 Left 1039483926 8:37897156-37897178 CCTCACATCAAGGCTAGTTTTAT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1039483928 8:37897196-37897218 ATGCCTATTCATCTCTGGCCAGG No data
1039483925_1039483928 21 Left 1039483925 8:37897152-37897174 CCATCCTCACATCAAGGCTAGTT 0: 1
1: 0
2: 2
3: 10
4: 124
Right 1039483928 8:37897196-37897218 ATGCCTATTCATCTCTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039483928 Original CRISPR ATGCCTATTCATCTCTGGCC AGG Intronic
No off target data available for this crispr