ID: 1039485217

View in Genome Browser
Species Human (GRCh38)
Location 8:37904542-37904564
Sequence ATGGAGGAGCAGAAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039485209_1039485217 1 Left 1039485209 8:37904518-37904540 CCAGGTGGGCTCTTGTGCTAGCC No data
Right 1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG No data
1039485206_1039485217 16 Left 1039485206 8:37904503-37904525 CCATCTCTGGGGACTCCAGGTGG No data
Right 1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039485217 Original CRISPR ATGGAGGAGCAGAAAGGGGC TGG Intergenic
No off target data available for this crispr