ID: 1039486097

View in Genome Browser
Species Human (GRCh38)
Location 8:37911216-37911238
Sequence ATTGCTAATATAAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039486097_1039486103 24 Left 1039486097 8:37911216-37911238 CCTTCCACCTTTATATTAGCAAT No data
Right 1039486103 8:37911263-37911285 AAGTTAATTTTTTTGAGACAGGG No data
1039486097_1039486102 23 Left 1039486097 8:37911216-37911238 CCTTCCACCTTTATATTAGCAAT No data
Right 1039486102 8:37911262-37911284 AAAGTTAATTTTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039486097 Original CRISPR ATTGCTAATATAAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr