ID: 1039488740

View in Genome Browser
Species Human (GRCh38)
Location 8:37931776-37931798
Sequence TCTGGACACCAAGGCTTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039488740_1039488749 25 Left 1039488740 8:37931776-37931798 CCCCCTAAGCCTTGGTGTCCAGA No data
Right 1039488749 8:37931824-37931846 GTCATGCAGTACCCATATAACGG No data
1039488740_1039488747 -10 Left 1039488740 8:37931776-37931798 CCCCCTAAGCCTTGGTGTCCAGA No data
Right 1039488747 8:37931789-37931811 GGTGTCCAGAGTTTTTATTGGGG 0: 19
1: 52
2: 138
3: 200
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039488740 Original CRISPR TCTGGACACCAAGGCTTAGG GGG (reversed) Intergenic
No off target data available for this crispr