ID: 1039488741

View in Genome Browser
Species Human (GRCh38)
Location 8:37931777-37931799
Sequence CTCTGGACACCAAGGCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039488741_1039488749 24 Left 1039488741 8:37931777-37931799 CCCCTAAGCCTTGGTGTCCAGAG No data
Right 1039488749 8:37931824-37931846 GTCATGCAGTACCCATATAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039488741 Original CRISPR CTCTGGACACCAAGGCTTAG GGG (reversed) Intergenic
No off target data available for this crispr