ID: 1039489519

View in Genome Browser
Species Human (GRCh38)
Location 8:37937093-37937115
Sequence CACCCAGGAGTGGCGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039489509_1039489519 26 Left 1039489509 8:37937044-37937066 CCATGTGGGATCTGCTGCAGGTA 0: 1
1: 0
2: 1
3: 12
4: 216
Right 1039489519 8:37937093-37937115 CACCCAGGAGTGGCGGCCCCAGG 0: 1
1: 1
2: 2
3: 23
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039489519 Original CRISPR CACCCAGGAGTGGCGGCCCC AGG Intronic
900102875 1:970309-970331 CACTCAGGAATGGCTGCTCCAGG - Exonic
900327393 1:2115368-2115390 CACCCAGGAGTGGAGTTTCCGGG + Intronic
900659141 1:3774220-3774242 CCCCCAGGAGTGGGGTCCTCGGG - Intronic
900777552 1:4596048-4596070 CACCCAGCCGTGGCAGCCCTGGG - Intergenic
900986198 1:6073986-6074008 CACCCAGCAGTGGATGCCTCGGG + Intronic
901003998 1:6162933-6162955 AGACCAGGAGTGGCGGCCCAGGG + Intronic
901382563 1:8884313-8884335 GAGGCAGGAGTGCCGGCCCCTGG + Intergenic
903416348 1:23185891-23185913 CTCCCAGAAGTGGCAGCCCCTGG - Intergenic
903573772 1:24325168-24325190 CACCCAGCTCAGGCGGCCCCTGG + Intronic
904190167 1:28737207-28737229 TGCCCAGGAGCGGCGGGCCCGGG - Intronic
905864965 1:41371763-41371785 AACCCAGGACTGCCCGCCCCTGG + Intronic
911188602 1:94926966-94926988 CCCCGAGGAGTGGCCGCCGCGGG + Exonic
912576311 1:110675180-110675202 CACCCAGCAGAGCCGGCCCACGG + Intergenic
915841802 1:159219043-159219065 CACCAAGGAGAGGTGGCACCTGG + Intergenic
917958690 1:180125707-180125729 CACCCAGGAATGGTGGGCCCGGG + Intergenic
918309406 1:183275024-183275046 CAGCCAGGAGTTCCTGCCCCAGG + Intronic
920338209 1:205258973-205258995 CACCCAGGCCTGCCAGCCCCGGG + Intronic
920366016 1:205448773-205448795 TACCCAGGATGGGGGGCCCCAGG + Intronic
922806942 1:228395077-228395099 CTCCCAGTAGTGGCGGCCTGAGG + Exonic
922986641 1:229871234-229871256 CTCCCAGGAGGGGAGGCCCAGGG - Intergenic
924042506 1:239997768-239997790 CCCCCAGGACTGGCGGCCCCGGG + Intergenic
924385728 1:243496662-243496684 CAGCCAGAAGTGGCAGCCCGGGG - Intronic
924772135 1:247087884-247087906 CAGCCAGGAGGGGAGGACCCAGG + Intergenic
1062828506 10:588866-588888 TACCCAGGAGTGGGGTCACCGGG + Intronic
1065983876 10:30930336-30930358 AGCCCAGGAGTGTCGGCCCTGGG - Intronic
1067458530 10:46440666-46440688 GAGCCAGGAGTGTCTGCCCCAGG + Intergenic
1067628669 10:47943970-47943992 GAGCCAGGAGTGTCTGCCCCAGG - Intergenic
1067732180 10:48820401-48820423 CCCCAAGCAGTGGCTGCCCCTGG + Exonic
1070592634 10:77811659-77811681 TAGCCAGGAGTTGTGGCCCCGGG - Intronic
1070717543 10:78733466-78733488 CACCCAGGTGTGGGGGGCCGTGG + Intergenic
1070954387 10:80454637-80454659 GAACCAGGAGTGCCGGCCCCGGG - Intronic
1076715052 10:132359482-132359504 CACCCAGCAGTGGCCACCCAAGG - Intronic
1077179400 11:1205519-1205541 CACACAGGCGTGGCTCCCCCAGG + Intergenic
1077364655 11:2156648-2156670 CACCCGTGAATGGCGGCTCCTGG + Intronic
1077685055 11:4283369-4283391 CTCCCAGGAGGGGCGGCTGCTGG - Intergenic
1077690133 11:4334561-4334583 CTCCCAGGAGGGGCGGCTGCTGG + Intergenic
1078547983 11:12260049-12260071 CCCAGAGGAGTGGCAGCCCCAGG - Intronic
1083674938 11:64319839-64319861 CATCCAGGGGTGAAGGCCCCAGG - Exonic
1084603981 11:70162092-70162114 GACCCGGGAGTGAGGGCCCCGGG + Intronic
1084680416 11:70663313-70663335 CACCCCGGATTGGGGGGCCCTGG + Intronic
1086488949 11:87339651-87339673 TACCTAGGAGTGGAGTCCCCAGG + Intergenic
1086769678 11:90746000-90746022 CACACAGGTGGGGCGGCCTCAGG - Intergenic
1089012080 11:115139643-115139665 CACCCAGGAGTGGGGCCAGCAGG - Intergenic
1089168731 11:116498123-116498145 CAGCCTGGAGTGGAGGCACCAGG + Intergenic
1091541451 12:1466206-1466228 CACCAAGGAGAGGGGGCCTCAGG - Intronic
1092746198 12:11674815-11674837 GCCCCAGGAGCGGAGGCCCCTGG + Intronic
1096983718 12:55743358-55743380 CGCCCTGGAGCTGCGGCCCCGGG + Exonic
1101785845 12:107882965-107882987 CTCCCAGTAGTGGCGGCCAGAGG - Intergenic
1102038074 12:109783429-109783451 CACCCTGGGGTGGGGGCTCCCGG - Exonic
1102635726 12:114321854-114321876 CACCCTGGAATGTAGGCCCCAGG + Intergenic
1111180690 13:84660349-84660371 AACCCAGGAATAGTGGCCCCTGG - Intergenic
1113426979 13:110216269-110216291 CACCCTGCAGTGATGGCCCCAGG + Intronic
1117565639 14:56991191-56991213 CCCCCAGCAGTGCCGGCCCACGG + Intergenic
1120765580 14:88324129-88324151 CTCCCGGAAGCGGCGGCCCCGGG + Intronic
1120874949 14:89367356-89367378 CACCCTGATGTGGCGGCACCCGG + Intronic
1121111475 14:91316041-91316063 CACCCAGCGGTGGCGGCCTCAGG - Intronic
1121328091 14:93033533-93033555 CACCCAGGAGTGAGGGCCCCAGG + Intronic
1121633766 14:95439945-95439967 CACCGGGGAGAGGCGGGCCCGGG - Exonic
1122264832 14:100541696-100541718 CAGCCAGGAGTGGCTGCCACTGG + Intronic
1122880131 14:104687103-104687125 CACCCAGGAGGGGAGGCTCCAGG + Intergenic
1128112973 15:65088082-65088104 GACCCAGGACTGACAGCCCCAGG - Intergenic
1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG + Intronic
1130963751 15:88682140-88682162 CTCCCAGGAGTGGAGGCCAACGG - Intergenic
1132745723 16:1435422-1435444 CACCCCGGTGTGGGGGCTCCAGG + Intronic
1132932115 16:2464154-2464176 CACCCAGGAGCTGCAGACCCTGG + Exonic
1133414958 16:5599274-5599296 CGCCCTGGTGTGACGGCCCCAGG + Intergenic
1134487140 16:14667564-14667586 CACCCAGGAGTCCGGGCCCTGGG - Intronic
1137555085 16:49465258-49465280 GACCCAGGAGTGGCGACCGGCGG + Intergenic
1140124354 16:72107542-72107564 AACACAGGTGAGGCGGCCCCGGG + Exonic
1140346306 16:74216360-74216382 CACCTTGGAGTGGTGCCCCCTGG + Intergenic
1142001041 16:87664704-87664726 CACCCCGGAGTGAAGGCCACTGG + Intronic
1142157085 16:88537545-88537567 CTGCCAGGTGTGGGGGCCCCAGG - Intergenic
1142896570 17:2983017-2983039 CAGGCAGGAGTGGAGGCTCCAGG + Intronic
1142982237 17:3678964-3678986 CCCCCAGGAATCGCGGCCCAAGG + Intronic
1143565167 17:7716659-7716681 CTACCAGGAGTGGCAGTCCCTGG - Intergenic
1144671270 17:17133948-17133970 CAGCCAGGTGTGCAGGCCCCGGG + Intronic
1144867751 17:18347739-18347761 CACCCAGGAGTGGCGAGAACAGG + Intronic
1147215316 17:38895919-38895941 CTCCCAGGAGTGGGGTCCTCTGG + Intronic
1148700003 17:49581560-49581582 CACTCAGGAGAGACGGCCCCTGG - Intronic
1148858112 17:50590272-50590294 CACCCAGGGGCAGGGGCCCCAGG - Intronic
1151219612 17:72602865-72602887 CACCCAGAAGTGCCAGCACCAGG + Intergenic
1151656188 17:75497130-75497152 TACTCAGGAGTGGCGGCAGCTGG - Exonic
1151933323 17:77246965-77246987 CACCCAGGTGAGGCGGGCGCGGG + Intergenic
1151975243 17:77480677-77480699 CACCCAGCAGGGGCAGCCACAGG - Intronic
1152046915 17:77942818-77942840 CACCCCAGGGTGGCAGCCCCTGG - Intergenic
1152587614 17:81196059-81196081 AACCTAGGAGGGGCAGCCCCAGG - Intronic
1152784397 17:82240432-82240454 CACCCAGGGGTTGCCGCCTCTGG + Intronic
1152811030 17:82382938-82382960 GACCCAGGTGTGGGGGTCCCGGG + Intergenic
1152942288 17:83178977-83178999 CAGCCAGGAGAGGCGGCACAGGG - Intergenic
1152961966 18:85542-85564 CTCCCAGGAGTGAGGCCCCCAGG + Intergenic
1153408751 18:4770050-4770072 CAGCCAGGTGTGGCGGGCCAAGG + Intergenic
1154009782 18:10564785-10564807 CACCCAGGGGTGCTGGCCCATGG + Intergenic
1159210779 18:65318669-65318691 CATCCAGGAGAGTCTGCCCCAGG - Intergenic
1159935300 18:74360948-74360970 CACCCAGAAATGGCAGCTCCTGG + Intergenic
1160473869 18:79165773-79165795 CACCCAGGAGGGGCTGGCCATGG + Intronic
1160691280 19:461562-461584 AACCCAGGAGTGCCGGCTCGGGG + Intergenic
1160720374 19:594555-594577 CCACCAGGACAGGCGGCCCCTGG + Intronic
1160949611 19:1659080-1659102 CAACCAGGAGTGGCGGAGACGGG - Intergenic
1160964840 19:1742807-1742829 CTCCCTCGAGTGGCGTCCCCAGG + Intergenic
1161106617 19:2446782-2446804 CACCCAGGAGTGGAGTTACCGGG - Intronic
1161168941 19:2803585-2803607 CACCCAGGAGTGACGGCTGGCGG - Intronic
1161175892 19:2841891-2841913 CTCCGAGGCGTCGCGGCCCCGGG - Intronic
1161227023 19:3151441-3151463 CATCGAGGAGTGGTGTCCCCCGG - Intronic
1161595841 19:5150645-5150667 CGCCCAGGAGCTGCGGCACCAGG - Intronic
1162036698 19:7943886-7943908 CTCCCAGGAGTGCCCTCCCCCGG - Exonic
1162918886 19:13888887-13888909 TCCCCAGGAGTGCCAGCCCCTGG - Intronic
1163268537 19:16235519-16235541 GGCCCAGGAGTGGTGGCCCATGG - Intronic
1163797618 19:19346441-19346463 CACCCAGGAGTGATGGAGCCAGG + Intronic
1164678377 19:30118111-30118133 CACCAAACAGTGGAGGCCCCAGG - Intergenic
1164945132 19:32286992-32287014 CACCCAGGGGTTGGGGACCCCGG + Intergenic
1165407947 19:35642232-35642254 GACCCAGGAGTCCAGGCCCCCGG - Intronic
1165422150 19:35727616-35727638 CACCCAGGTCTGGAGGGCCCTGG + Exonic
1166502627 19:43353279-43353301 GACCCAGGAGTCCAGGCCCCAGG - Intergenic
1166674578 19:44732237-44732259 CACACAGCAGTGACAGCCCCAGG + Intergenic
1166683452 19:44781674-44781696 GACCCAGGAGTCCAGGCCCCAGG - Intronic
1166683466 19:44781710-44781732 GACCCAGGAGTCCAGGCCCCAGG - Intronic
1166683480 19:44781746-44781768 GACCCAGGAGTCCAGGCCCCAGG - Intronic
1166683550 19:44781931-44781953 GACCCAGGAGTCCAGGCCCCAGG - Intronic
1167264989 19:48478845-48478867 GACCCAGGAGTCCAGGCCCCCGG - Intronic
1167265004 19:48478882-48478904 CACCCAGGAGTCCAGGCCCCCGG - Intronic
1167265020 19:48478919-48478941 GACCCAGGAGTCCAGGCCCCCGG - Intronic
1167265051 19:48478993-48479015 GACCCAGGAGTCCAGGCCCCCGG - Intronic
1167265805 19:48482745-48482767 GACCCAGGAGTTGGGGACCCCGG + Intergenic
1167423765 19:49418871-49418893 CACCCAGGATGGCTGGCCCCAGG + Intergenic
1167495910 19:49818654-49818676 GACCCAGGAGTCCAGGCCCCCGG - Intronic
1167630902 19:50625734-50625756 GACCCAGGAGTCCAGGCCCCTGG + Intronic
1167630928 19:50625808-50625830 GACCCAGGAGTCCAGGCCCCTGG + Intronic
1167793073 19:51692587-51692609 GACCCAGGAGTCCGGGCCCCCGG - Intergenic
1168107087 19:54172181-54172203 GACCCAGGAGTCCAGGCCCCCGG + Intronic
1168107101 19:54172218-54172240 GACCCAGGAGTCCAGGCCCCCGG + Intronic
1168107115 19:54172255-54172277 GACCCAGGAGTCCAGGCCCCCGG + Intronic
1168107129 19:54172292-54172314 GACCCAGGAGTCCAGGCCCCCGG + Intronic
1168107143 19:54172329-54172351 GACCCAGGAGTCCAGGCCCCCGG + Intronic
1168107157 19:54172366-54172388 GACCCAGGAGTCCAGGCCCCCGG + Intronic
1168107184 19:54172440-54172462 GACCCAGGAGTCCAGGCCCCCGG + Intronic
1168107213 19:54172514-54172536 GACCCAGGAGTCCAGGCCCCCGG + Intronic
1168169104 19:54574592-54574614 CACTCAGGAGTCCCAGCCCCAGG + Intronic
1168317112 19:55489205-55489227 CACCCAGGAGTCTGGGCCCAGGG + Intronic
1168332283 19:55577812-55577834 CACTAAGGAGTGGGGGGCCCTGG - Exonic
1168407396 19:56118070-56118092 AGCCCAGGTGGGGCGGCCCCAGG - Intronic
925015082 2:517704-517726 AACCCTGGAGTGGCGGCCCTTGG + Intergenic
925554911 2:5120465-5120487 CACTCAGGAGTGCCTGCCCCTGG - Intergenic
926103096 2:10133113-10133135 CACCCAGGACTGACGTCCACTGG - Intergenic
927690406 2:25204291-25204313 CACCCAGGCGTGGGGTCCTCGGG + Intergenic
929890864 2:45917860-45917882 CCCCCAGCAGTGCCGGCCCACGG - Intronic
932892288 2:75607592-75607614 CCTCCAGGTGTGGCAGCCCCAGG + Intergenic
937309108 2:120891191-120891213 CACCCAGGAGTGGGTGCACTGGG + Intronic
937921464 2:127134729-127134751 CAGGCAGGAGTGGGGGCCCTTGG - Intergenic
938370418 2:130764608-130764630 CAGCCAGAAGTGGGGGCCTCTGG + Exonic
945664225 2:212721258-212721280 CCCCCAGCAGTGCCGGCCCATGG - Intergenic
948488526 2:238296760-238296782 GACCACGGTGTGGCGGCCCCAGG + Intergenic
948847528 2:240690302-240690324 CTCCAAGGAGGGGAGGCCCCAGG - Intergenic
948942890 2:241204809-241204831 AACCCAGGCTTGGGGGCCCCAGG - Intronic
949046958 2:241876737-241876759 CACCCTGCAGTTGCGCCCCCGGG - Intergenic
1171187978 20:23137043-23137065 CACCCTGGAGGGGCTGCACCAGG + Intergenic
1173404463 20:42752857-42752879 CACCCTGGAGTGGGTGCCCAGGG - Intronic
1173958253 20:47051468-47051490 AACCCAGGAGTGTCTGCCTCGGG - Intronic
1174053781 20:47785028-47785050 CACCGAGCACAGGCGGCCCCGGG - Intronic
1174479225 20:50819243-50819265 CAGCCAGGTGTGGAGCCCCCAGG + Intronic
1175488723 20:59364389-59364411 CTCACGGGAGTGGCTGCCCCAGG + Intergenic
1175908784 20:62394818-62394840 CCCCCAGGTGCGGCTGCCCCCGG - Intronic
1175997204 20:62817197-62817219 CACCCCGGAGTGGCGGGTTCGGG - Intronic
1176171217 20:63697216-63697238 CCCCCAGGAGTGGTGGCCGGAGG + Intronic
1176215470 20:63945732-63945754 AACCCAGGAGTTGCGGAGCCTGG + Intronic
1179789868 21:43750031-43750053 CACGCAGGGGTGGGGGCGCCTGG + Intronic
1180207577 21:46271306-46271328 AACCCAGGTGTGGTGGCCCATGG - Intronic
1180789206 22:18565273-18565295 ACCCCAGGTGTGGAGGCCCCAGG - Intergenic
1181037052 22:20174753-20174775 CACCCAGGAGCTGGGGGCCCTGG + Intergenic
1181232535 22:21430038-21430060 ACCCCAGGTGTGGAGGCCCCAGG + Intronic
1181246116 22:21504819-21504841 ACCCCAGGTGTGGAGGCCCCAGG - Intergenic
1181558583 22:23686459-23686481 GACCCTGGAGTGGCTGCCCCAGG + Intergenic
1181854410 22:25771896-25771918 TACCCAGGAGTGGAGGCCAATGG - Intronic
1182083968 22:27548660-27548682 CTCCCAGGGCTGGGGGCCCCAGG - Intergenic
1182127632 22:27827721-27827743 CAGCCAGGAGACGGGGCCCCTGG + Intergenic
1182315229 22:29441695-29441717 CTCCCAGTAGTGGCGGCCACAGG - Exonic
1182424800 22:30266351-30266373 CAGCCAGGCCTGGGGGCCCCAGG - Intronic
1182694853 22:32191177-32191199 CTCCCAGCAGTGGCGGCCACAGG + Exonic
1182716531 22:32360405-32360427 CTCCCAGTAGTGGCGGCCACAGG - Exonic
1183326576 22:37197861-37197883 CACCCAGGTTTGTCTGCCCCAGG - Intronic
1183393852 22:37560705-37560727 CGCCCGGGAGAGGCGCCCCCGGG + Intronic
1183640924 22:39091930-39091952 CACCTAGGAGGGGCAGGCCCAGG + Intergenic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184362135 22:44024851-44024873 CACCCAGTAGTGGGTCCCCCAGG - Intronic
1184479323 22:44737702-44737724 CACCCTGAAGGGGCGCCCCCAGG - Intronic
1184680811 22:46071381-46071403 AACCCAGGAGGGGCGGCGCCCGG + Intronic
1185323028 22:50210545-50210567 CACCCTGGAGGGGAGGCCCAGGG - Intronic
949507427 3:4740624-4740646 CTCCCAGGGGTGGTGTCCCCAGG + Intronic
950073957 3:10174023-10174045 CACCCACGAGGGGTGGCCCTGGG + Intronic
952679571 3:36074889-36074911 CACCCAGGAGTGGCAGGACAAGG - Intergenic
953406827 3:42663935-42663957 CACACAGGTGCGGCTGCCCCTGG + Exonic
953687726 3:45091323-45091345 CATCCAGGAGCAGCGGACCCGGG - Exonic
954106002 3:48410150-48410172 CTCCCAGGGGTGGGGGCACCTGG + Intronic
954133417 3:48571135-48571157 GACCCAGGAGTCGGGGTCCCGGG - Exonic
956430642 3:69182662-69182684 AACTCTGGAGAGGCGGCCCCAGG - Exonic
956716587 3:72085332-72085354 CACCCAGGTGTGGCAGCTCCTGG - Intergenic
956717001 3:72087775-72087797 CACCCAGGTGTGGCAGCTCCTGG - Intergenic
960281420 3:115784725-115784747 CACCCAGAAGTGACGCTCCCCGG - Intergenic
961688810 3:128653571-128653593 CCCCCAGCAGTGCCGGCCCACGG + Intronic
963897567 3:150703421-150703443 CACCCAGGAGTGGGTGGACCAGG + Intronic
965040301 3:163499194-163499216 CCCCCAGCAGTGCCGGCCCACGG + Intergenic
965547574 3:169931787-169931809 CCCCGAGGAGGGGCAGCCCCAGG - Intronic
965752375 3:171989673-171989695 CACCCAGTTGTGGCAGCCTCGGG - Intergenic
966635501 3:182128804-182128826 CACCAAGGCGTGGCAGCCCCTGG + Intergenic
968309981 3:197675285-197675307 CACCAAGGCGTGGTGTCCCCTGG + Intronic
968350140 3:198046732-198046754 AGCCCAGGAGGGGCAGCCCCAGG - Intergenic
968534094 4:1113003-1113025 CACCGGGGAGTGGGGGCCGCGGG - Intronic
968599510 4:1502430-1502452 CCCCCAGGAGTGGGGGCTGCTGG - Intergenic
968607108 4:1540739-1540761 CACCCCGGAGTGAAGGTCCCTGG + Intergenic
968663203 4:1807234-1807256 CACCCAGCAGTGGGGGCTCGCGG + Exonic
968812610 4:2806732-2806754 CTTCCAGGTGTGGAGGCCCCCGG + Intronic
968881069 4:3300481-3300503 CTCCTAGGAGGGGCGGGCCCAGG - Intronic
968947367 4:3672278-3672300 CACCCAGGAGTGGCGGCTCCAGG - Intergenic
969053320 4:4387290-4387312 CGCCCGGGTGCGGCGGCCCCAGG + Intronic
969112560 4:4852827-4852849 GACCCAGGAGCAGTGGCCCCAGG - Intergenic
969209699 4:5677419-5677441 CCCCCAGGACAGGCGCCCCCAGG - Intronic
969213944 4:5708475-5708497 CACCCACGTGGGGCGCCCCCGGG + Exonic
969871500 4:10107633-10107655 CCCCCAGGTGTGGAGGCCACTGG - Intronic
971669810 4:29542616-29542638 CACCCAAAACTGGCAGCCCCAGG + Intergenic
976281949 4:83334629-83334651 CACCCAGGAGCCGCTGCACCTGG - Exonic
976406387 4:84664863-84664885 CCCCCAGCAGTGCCGGCCCACGG + Intergenic
981169554 4:141605583-141605605 CCCCCAGCAGTGGTGGCCCACGG - Intergenic
985822051 5:2167043-2167065 CAGCCAGAAGAGGCAGCCCCAGG + Intergenic
987128534 5:14838568-14838590 CACACGTGAGTGGCAGCCCCTGG + Intronic
991550539 5:67831210-67831232 CACCCTGGTGTGAGGGCCCCTGG - Intergenic
992365674 5:76086616-76086638 AACCCAGGAAAGGCAGCCCCTGG + Intronic
994256260 5:97600143-97600165 CTCCCAGGAGTTGAAGCCCCTGG + Intergenic
997654518 5:135545334-135545356 CTCCCAGGGCTGGCGGCCTCAGG + Intergenic
999330699 5:150671857-150671879 CACCCAGCAGGGGCGGCTGCAGG - Exonic
999890891 5:155977665-155977687 CACCCAGGAGGGGAGGCATCAGG + Intronic
1001546391 5:172573087-172573109 AACTCTGGAGTAGCGGCCCCAGG - Intergenic
1002692387 5:181059393-181059415 CTCCCAGTAGTGGCGGCCGGCGG - Exonic
1005892666 6:30153092-30153114 CACCCAGAAGTGGCAACACCAGG + Exonic
1006168844 6:32081614-32081636 CCCCCAGGAGGGGCTGCTCCAGG + Intronic
1007113162 6:39325229-39325251 CAGCCAGGAGTGGAGCCCCAAGG - Intergenic
1007113439 6:39326954-39326976 CAGCCAGGAGTGGAGCCCCAAGG - Intergenic
1010388385 6:75308803-75308825 AAGCCAGTAGTGGCAGCCCCAGG - Exonic
1012717692 6:102698350-102698372 CAACCAGTAGTGGTGGCCACAGG - Intergenic
1015935710 6:138404423-138404445 CACGCAGGCGGGGCGGCCCGGGG + Exonic
1016901764 6:149109802-149109824 CAACCAAGAGTGCCTGCCCCAGG + Intergenic
1018066621 6:160129063-160129085 CACCCAGGAGGGGCTGTACCAGG + Intronic
1018404577 6:163465346-163465368 CAGCCAGGAGTGGTGGCTCATGG + Intronic
1018431356 6:163725330-163725352 CACCCAGGGGTGATGGCCCTGGG + Intergenic
1018679668 6:166253470-166253492 CTCCCTGGGGTGGCGGCCGCCGG - Intergenic
1018947452 6:168357231-168357253 TGCCCAGCAGGGGCGGCCCCAGG + Intergenic
1018947666 6:168357945-168357967 TGCCCAGCAGGGGCGGCCCCAGG + Intergenic
1018947686 6:168358000-168358022 TGCCCAGCAGGGGCGGCCCCAGG + Intergenic
1018947704 6:168358055-168358077 TGCCCAGCAGGGGCGGCCCCAGG + Intergenic
1018947724 6:168358110-168358132 TGCCCAGCAGGGGCGGCCCCAGG + Intergenic
1018947875 6:168358604-168358626 TGCCCAGCAGGGGCGGCCCCAGG + Intergenic
1018947893 6:168358659-168358681 TGCCCAGCAGGGGCGGCCCCAGG + Intergenic
1018947913 6:168358714-168358736 TGCCCAGCAGGGGCGGCCCCAGG + Intergenic
1019048649 6:169167117-169167139 TTCCAAGGAGTGGCGGCCCAAGG + Intergenic
1019199964 6:170306389-170306411 CACTGAGGACTGGCGGCTCCCGG - Intronic
1019330624 7:458871-458893 CACCCAGGAGTGACAAGCCCAGG + Intergenic
1019430417 7:996505-996527 CACCCAGGTGCTGCTGCCCCGGG - Intergenic
1019662613 7:2233040-2233062 CTCCCAGGGGTGGCGGCTCCGGG - Exonic
1020099946 7:5389046-5389068 CAGCCAGGCGCGGGGGCCCCCGG + Exonic
1022939394 7:35218407-35218429 CACACAGCAGTTGGGGCCCCAGG - Intronic
1024197110 7:47069873-47069895 CTCCCAGGAGCGGTGGCCGCAGG - Intergenic
1025095317 7:56091763-56091785 CACCCAGTAGTGGGGCCACCAGG - Intronic
1026787909 7:73313329-73313351 CTCCCAGTAGTGGCGGCCGCAGG + Exonic
1028621981 7:92835721-92835743 CACGCGGGAGTCGCGGTCCCCGG - Intronic
1031629948 7:124033320-124033342 CAGCCAGGGGAGGCGGCGCCGGG + Intergenic
1031972018 7:128072015-128072037 CACCCTGCAGTGTTGGCCCCAGG + Intronic
1032197905 7:129799782-129799804 CAGCCAGGCCTGGAGGCCCCAGG + Intergenic
1032239985 7:130153196-130153218 CAGCCAGGGGTGGCAGCCACTGG + Intergenic
1034391543 7:150791461-150791483 GAGCCAGGAGTGGGGGCCCTGGG + Exonic
1035283511 7:157792359-157792381 GACCCAGGAGAGGTGGCCCCGGG - Intronic
1035284858 7:157799583-157799605 CACGCTGGAGTGGAGGCCCTGGG - Intronic
1038200709 8:25410231-25410253 TTCCCAGGAGTGGCGCTCCCTGG - Intronic
1038398269 8:27262835-27262857 CACCAAGCAGTGGCTGCCCTGGG - Intergenic
1039489519 8:37937093-37937115 CACCCAGGAGTGGCGGCCCCAGG + Intronic
1040415111 8:47188773-47188795 CTCCCAGCGGTGGCGGCTCCTGG - Intergenic
1041791423 8:61700101-61700123 CTGCCAGGAGTGGAGGCCCAGGG + Intronic
1042376832 8:68061495-68061517 CACCCAGGAGTGGCGGGACAAGG + Intronic
1049175182 8:141188078-141188100 CAGCCAGGCGTGGTGGCCCATGG + Intronic
1049224229 8:141441959-141441981 GACCCAGGATTGGCGGAGCCGGG + Intergenic
1049537351 8:143188559-143188581 CACACAGGCGTGGCTGCTCCGGG + Intergenic
1049929949 9:446486-446508 CACCCTGGAGGGGCGGCCTCGGG + Exonic
1050350847 9:4740618-4740640 CCCCCAAGAGTGGCTGCCACTGG + Intronic
1057786028 9:98087824-98087846 CTCCCAGTAGTGGCGGCCGGTGG + Exonic
1058585248 9:106500844-106500866 CAGCCAGCAGTGGCAACCCCTGG - Intergenic
1060519684 9:124287208-124287230 AACCCAGGATTGGGGCCCCCAGG + Intronic
1061110554 9:128566782-128566804 CATCCAGGAGAGGCGGCAGCAGG + Exonic
1061475915 9:130866208-130866230 CAGCCAGGAGTGGCAGCATCAGG + Intronic
1061926383 9:133808037-133808059 CACGCCCGGGTGGCGGCCCCAGG + Intronic
1062070108 9:134550803-134550825 CACCCAGGAGAGGGGGCCGAAGG - Intergenic
1062319310 9:135982668-135982690 CAGCCAGGAGGAGCGGTCCCGGG + Intergenic
1062428206 9:136515746-136515768 GACTTAGGACTGGCGGCCCCCGG + Intronic
1062550978 9:137086430-137086452 CACCCAGGCGTGGGGGCCGGGGG - Intergenic
1062616190 9:137397051-137397073 CTCCCAGGACCCGCGGCCCCAGG + Intronic
1062716347 9:138012151-138012173 CACCCAGGAGTGGGGGAGACAGG + Intronic
1187518106 X:19990824-19990846 CACCCAGGAGGGGCGGTTCTCGG - Intergenic
1190116336 X:47628129-47628151 GACCCTGGAGTGGCAGCTCCAGG - Exonic
1191618630 X:63192760-63192782 CCCCCAGCAGTGCCGGCCCACGG - Intergenic
1199255169 X:145711073-145711095 CACCCAGGGGTGGATGGCCCAGG - Intergenic