ID: 1039495350

View in Genome Browser
Species Human (GRCh38)
Location 8:37976040-37976062
Sequence CTTTATCCCATCACGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039495340_1039495350 25 Left 1039495340 8:37975992-37976014 CCAGTCCTGTGGGAGAGGCAGCT No data
Right 1039495350 8:37976040-37976062 CTTTATCCCATCACGGAGAGGGG No data
1039495341_1039495350 20 Left 1039495341 8:37975997-37976019 CCTGTGGGAGAGGCAGCTTTCGG No data
Right 1039495350 8:37976040-37976062 CTTTATCCCATCACGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039495350 Original CRISPR CTTTATCCCATCACGGAGAG GGG Intergenic
No off target data available for this crispr