ID: 1039500578

View in Genome Browser
Species Human (GRCh38)
Location 8:38013574-38013596
Sequence TCCCTATGTTGAGGAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039500576_1039500578 8 Left 1039500576 8:38013543-38013565 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039500578 Original CRISPR TCCCTATGTTGAGGAAGTGC TGG Intergenic
No off target data available for this crispr