ID: 1039502912

View in Genome Browser
Species Human (GRCh38)
Location 8:38031073-38031095
Sequence GATCCAGGAGAGGCCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039502903_1039502912 12 Left 1039502903 8:38031038-38031060 CCGAAGCGGGAGAGGGCGGAGTT 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG No data
1039502902_1039502912 13 Left 1039502902 8:38031037-38031059 CCCGAAGCGGGAGAGGGCGGAGT 0: 1
1: 0
2: 0
3: 7
4: 145
Right 1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039502912 Original CRISPR GATCCAGGAGAGGCCTGGCC TGG Intronic
No off target data available for this crispr