ID: 1039503948

View in Genome Browser
Species Human (GRCh38)
Location 8:38038092-38038114
Sequence CTGTATGAGGATAAGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039503948_1039503952 -3 Left 1039503948 8:38038092-38038114 CCCTCCTACTTATCCTCATACAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1039503952 8:38038112-38038134 CAGATAGTCCCCGATTATGATGG No data
1039503948_1039503956 26 Left 1039503948 8:38038092-38038114 CCCTCCTACTTATCCTCATACAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1039503956 8:38038141-38038163 TACAATTTTTGACTTTACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039503948 Original CRISPR CTGTATGAGGATAAGTAGGA GGG (reversed) Intronic
900381733 1:2387530-2387552 CTGCATGTGGACAAGGAGGAGGG + Intronic
902287703 1:15417259-15417281 CTGTAAGAGGATAAGATGTATGG + Intronic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
906788039 1:48633340-48633362 CTCAATGAGGGTAAGTAGAATGG + Intronic
909075809 1:71048619-71048641 TTGTATGAAGATAAGAAGGATGG - Intergenic
910021792 1:82599673-82599695 ATGAATGAGGACAAGAAGGAAGG - Intergenic
910179024 1:84461459-84461481 CCGTATGAGATTAAGAAGGAGGG - Intergenic
913282109 1:117195905-117195927 CTTTAGGAGGATGAGTAGGGAGG + Intronic
915012382 1:152699392-152699414 TTGTATGAGGTAAAGTGGGAAGG - Exonic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
920306657 1:205022463-205022485 GTGTGTGTGGATATGTAGGAAGG - Exonic
920840435 1:209549483-209549505 CTGGAGGAGGAATAGTAGGAGGG - Intergenic
921596001 1:217054356-217054378 CCATATGAGGTTAAATAGGAAGG - Intronic
923360996 1:233211032-233211054 CTCTAAGAGGATAATTAGGATGG - Intronic
924179029 1:241423140-241423162 ATGTAGGAGAATTAGTAGGATGG + Intergenic
924585830 1:245360312-245360334 TGGGATGAGGATAAGGAGGATGG - Intronic
1064202563 10:13297343-13297365 TTGTATGAGAATATTTAGGAAGG + Intronic
1064230383 10:13524887-13524909 CTTTAAGAGGAAAAATAGGAGGG - Intronic
1065119595 10:22515630-22515652 CTTTAGGAGGAGAATTAGGAGGG + Intergenic
1066254191 10:33662785-33662807 CTGTTTGAAGGTAGGTAGGAGGG - Intergenic
1070339809 10:75487593-75487615 CTGTAAGAGAATAGGAAGGAGGG - Intronic
1070983077 10:80665888-80665910 CTGTATGAGGAAAAGAAGATGGG - Intergenic
1071911624 10:90241628-90241650 CAGTATGAGGATTAGTACTAAGG - Intergenic
1072215971 10:93287386-93287408 CTGTATGGGGTTAAGTAAGGAGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1076343023 10:129762612-129762634 CTGTCTGAGGATGAAGAGGAAGG - Intronic
1077925020 11:6672990-6673012 GAGAATGAGGATAAGTAAGAGGG - Intergenic
1082757788 11:57095242-57095264 CTGTATGAAGATAAGAAGATTGG - Intergenic
1083592978 11:63906004-63906026 CGGTATGTGGATAAGCAGGTGGG - Intronic
1087322969 11:96685574-96685596 ATGTATGAGGCAAAGTAGCATGG + Intergenic
1088679873 11:112230416-112230438 CTGTATGTGGACAGGTAGAAGGG + Intronic
1092564488 12:9649742-9649764 CTGTCTCAGTATTAGTAGGAGGG + Intergenic
1096618021 12:52845366-52845388 CTGTCTGAGGAAATGCAGGAAGG - Intronic
1097907771 12:64938200-64938222 CTGAAAGAGAATAAGTAGGAAGG + Intergenic
1097952262 12:65444932-65444954 CTGGATAAGGATATGTAGGAGGG - Intronic
1097957033 12:65496713-65496735 CTCTATGAGGACAAGTCTGAAGG - Intergenic
1099586381 12:84522038-84522060 CTGTCTGAGGAAAAGTAGACAGG - Intergenic
1102436107 12:112925286-112925308 TTGTATGAGGAAAAGGGGGAGGG - Intronic
1105690383 13:22831608-22831630 CTGAATGAGGATAAGGAGTTTGG - Intergenic
1106004188 13:25753195-25753217 CTGTATGAGCAAAAGTGGCAGGG + Intronic
1106364725 13:29067373-29067395 GTGTATGAGGCTAAGGAAGAGGG + Intronic
1106821368 13:33468213-33468235 ATGCATGAGGATAAGTAGAATGG - Intergenic
1108601820 13:52001409-52001431 GAGTGTGAGGATAAGTTGGAAGG - Intronic
1112574804 13:100626328-100626350 CTGTAAGAGGATCAGAAGAAAGG + Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1115362043 14:32514791-32514813 CTGGGAAAGGATAAGTAGGAGGG + Intronic
1117238679 14:53805492-53805514 GTTTATAAGGATAAGTAAGATGG - Intergenic
1118130573 14:62958402-62958424 GTGTCTGAGGAGAAGTAGAAAGG - Intronic
1118314931 14:64720278-64720300 CTGTCTGGGGCCAAGTAGGATGG + Intronic
1120044918 14:79794843-79794865 CTATATGAGGATGAGCAGCAAGG + Intronic
1121254459 14:92521059-92521081 CTGGATGATGATTAGGAGGATGG - Intronic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124095489 15:26645002-26645024 TTGTAAGAGGCTAAGAAGGAAGG + Intronic
1126033655 15:44526230-44526252 CTGTTTGAGCATAAAAAGGAAGG - Exonic
1126399344 15:48253350-48253372 CTGCCTGAGGCTAAGTTGGAGGG - Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1129924401 15:79350028-79350050 CTGCATCAGGATAAGTAGCTTGG + Intronic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1135214410 16:20552433-20552455 ATGTTTAAGTATAAGTAGGAAGG + Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1142009129 16:87704885-87704907 CTGTGTGAGGATGAATTGGAGGG - Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143928786 17:10398555-10398577 CAGTATGAGGAAGAGCAGGAAGG - Exonic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144426376 17:15146245-15146267 CTAGATGAGGCTAATTAGGAAGG - Intergenic
1146032349 17:29377011-29377033 CTGTAAAAGGATTAGCAGGATGG - Intergenic
1146386648 17:32382819-32382841 CAGTATGAGGATCAGTTAGAAGG + Intergenic
1146516570 17:33494221-33494243 TTGTTTGGGGATCAGTAGGAAGG + Intronic
1149458732 17:56810429-56810451 GTGTATGAGGGTATGTATGAGGG - Intronic
1151979349 17:77499429-77499451 CTGATTGAGGATAAAAAGGAAGG + Exonic
1203167043 17_GL000205v2_random:106965-106987 GTCTATGAGGAAAGGTAGGATGG - Intergenic
1153227455 18:2909505-2909527 CTGTCTGAGGATCAGCAGGCAGG - Intronic
1157485367 18:48083459-48083481 CTGTATGAGGAGGTGTGGGATGG - Intronic
1162922585 19:13912376-13912398 CCGGATGAGGATGAGGAGGAGGG + Exonic
1163121505 19:15221006-15221028 CTGAATGAGGTTAAGCAGGGAGG - Intergenic
1164881653 19:31738026-31738048 CTCTATGGGGATGAGAAGGAAGG + Intergenic
1168687152 19:58355920-58355942 CTGTCTGGGGACATGTAGGATGG - Exonic
930792174 2:55345307-55345329 CAGTATTAGGATAAGAAGGAGGG - Intronic
933983851 2:87574766-87574788 CTCTGTGAGGATGGGTAGGAGGG - Intergenic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
936310003 2:111376028-111376050 CTCTGTGAGGATGGGTAGGAGGG + Intergenic
936746596 2:115583807-115583829 CTCTATGAGGATAAGCATGCTGG + Intronic
940579804 2:155564177-155564199 ATGTCTGAGGAAAAGTAAGAAGG + Intergenic
941010843 2:160297817-160297839 TTGGAGGAGGATAAGCAGGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942244408 2:173993777-173993799 CTGTATGAGGCTCACTGGGATGG - Intergenic
942810359 2:179992112-179992134 CTGTAAGAGGATAGGAAGGGAGG + Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943957185 2:194207576-194207598 CTGTATGAGGTTGAGTGGCAAGG - Intergenic
944200476 2:197101972-197101994 GTGTATGAGGATGAAGAGGAAGG - Intronic
1169692023 20:8342841-8342863 CTGGAAGAGGATGAGTAGAAAGG + Intronic
1174029807 20:47613945-47613967 CTGTGAGGAGATAAGTAGGAGGG - Intronic
1176404716 21:6352134-6352156 GTCTATGAGGAAAGGTAGGATGG + Intergenic
1176432441 21:6636970-6636992 GTCTATGAGGAAAGGTAGGATGG - Intergenic
1177496113 21:21894567-21894589 CTGTAGGTGGATATGGAGGATGG + Intergenic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
950011393 3:9726713-9726735 ATGTTTGAGGGTGAGTAGGAAGG + Exonic
955992518 3:64643035-64643057 CTGTAAGAGGATAATTACAAGGG - Intronic
956146606 3:66197289-66197311 CTGTATGAGGATAGGCATCAGGG + Intronic
957239015 3:77634325-77634347 GTGTATGTGGATAAGTGGTAAGG + Intronic
957707603 3:83809834-83809856 GTGTATGATGACAAGTAGGGAGG + Intergenic
959334840 3:105051130-105051152 CTGCATGAGGATAAATTGAATGG + Intergenic
963472414 3:145757741-145757763 ATGTCTAAGGATAGGTAGGATGG + Intergenic
964681106 3:159340118-159340140 CTTTAAGAGGATAACTAGGAAGG + Intronic
964918780 3:161870601-161870623 CTGTATTAGGATAAGGTAGAAGG - Intergenic
966952434 3:184834053-184834075 TTGTATGAGGATGAGTAGAGGGG + Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
972097410 4:35364927-35364949 CAGTATTAGGAGAAGTAGCAGGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
973161987 4:47030982-47031004 CTGTAGGAGGCAGAGTAGGAGGG - Intronic
977989566 4:103424551-103424573 CTGTCTGAGGAATGGTAGGAAGG + Intergenic
978810989 4:112849713-112849735 CTGTATAAGGATTAGAAGAAGGG - Intronic
983059587 4:163142868-163142890 CTGTATGAGGAGAAGTGGGCCGG - Intronic
988586028 5:32508255-32508277 CAGTCTGAGGCTGAGTAGGATGG + Intergenic
990368717 5:55095304-55095326 CTATCTGAGGACAAGGAGGAGGG - Intergenic
990799316 5:59582417-59582439 CTCTATGAGGCTAGATAGGAAGG + Intronic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
993830141 5:92745994-92746016 CTTGAGGAGGATAACTAGGAAGG - Intergenic
995058902 5:107792964-107792986 CTGGATGAGGGTCATTAGGAAGG + Intergenic
996469259 5:123840909-123840931 CTGAATGAGCAAAAGTTGGAAGG + Intergenic
997356944 5:133268608-133268630 CTGTCTCAGGATGAGCAGGAAGG - Intronic
998590451 5:143472253-143472275 CTGTATGTGGATGAGTGGAACGG + Intergenic
1003693290 6:8376137-8376159 CTGTGGGAGCATATGTAGGATGG - Intergenic
1005827614 6:29644244-29644266 CTGAATAATTATAAGTAGGATGG + Intergenic
1006865624 6:37206970-37206992 CTGTATGAAGAAAAGTAGGACGG + Intergenic
1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG + Intergenic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1014898231 6:126930058-126930080 TTGTATGAGGTTTAGTAGGGAGG + Intergenic
1015750774 6:136556255-136556277 CTTTAGGAGGCTAAGGAGGACGG + Intergenic
1016428764 6:143961300-143961322 CTGTAAGAGGATCAGTTGGTTGG - Intronic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1016590305 6:145735878-145735900 CTTTATGAGGATCATAAGGAAGG + Exonic
1016689505 6:146920253-146920275 TAATCTGAGGATAAGTAGGAGGG + Intergenic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1024345174 7:48306047-48306069 CTGTTTGAGAGTAGGTAGGAGGG - Intronic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1027670723 7:81093688-81093710 CTGTATGAGGATTTGTAGGGTGG + Intergenic
1028890945 7:95988015-95988037 CTGTATGTGGACAAGCATGAAGG - Intronic
1032682216 7:134196451-134196473 CTTTATGAGGAAAAACAGGATGG + Intronic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1039503948 8:38038092-38038114 CTGTATGAGGATAAGTAGGAGGG - Intronic
1040896057 8:52369512-52369534 CTGTCTGGGCATAAGTAGGCTGG - Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1046165812 8:110433295-110433317 CTGTGTGAGGTTAAATAGGTTGG + Intergenic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1049865105 8:144930157-144930179 CTGTATAAAGAAAAGTAGGGTGG + Intergenic
1049982835 9:920607-920629 CTGTAAGAGGAATAGTGGGATGG + Intronic
1050085307 9:1959140-1959162 CTCTCAGAGGATAAGTAGGATGG + Intergenic
1050452509 9:5798153-5798175 CTGGATGAGAAGAAATAGGATGG - Intronic
1050569520 9:6922766-6922788 CTGCTTGAGGATATGTTGGAAGG - Intronic
1053467125 9:38316701-38316723 CTGTCAGAGGATAAGGAGGCAGG + Intergenic
1057745074 9:97745000-97745022 CTGTTTGAACATATGTAGGATGG - Intergenic
1062213035 9:135374798-135374820 CTGTAAGTGGATAAACAGGAAGG - Intergenic
1203427111 Un_GL000195v1:51323-51345 GTCTATGAGGATAGGTAGCATGG - Intergenic
1203439094 Un_GL000195v1:171742-171764 GTCTATGAGGAAAGGTAGGATGG + Intergenic
1185521777 X:745657-745679 CTGGATGAGGATGAGGAGGGTGG - Intergenic
1186996820 X:15132331-15132353 CTGTAAGAGGATGAGAAGGCAGG - Intergenic
1187243239 X:17531888-17531910 CACTATGAGGATAAGAAGGAGGG - Intronic
1188126100 X:26371182-26371204 CTTTATGAAGATAATTAGTAGGG + Intergenic
1188534436 X:31180747-31180769 CTCTTTGAGATTAAGTAGGAAGG + Intronic
1195048769 X:101078578-101078600 CTGAAGGATGATAAGTGGGAGGG + Intergenic
1197857024 X:130924924-130924946 TTCTATGAGGATAACTGGGAAGG - Intergenic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic