ID: 1039504731

View in Genome Browser
Species Human (GRCh38)
Location 8:38043732-38043754
Sequence CAGGGGTCTTATGAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039504731_1039504743 18 Left 1039504731 8:38043732-38043754 CCAGCAGCTTCATAAGACCCCTG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1039504743 8:38043773-38043795 GATCTTGGTTCTCTTTGTGGAGG No data
1039504731_1039504742 15 Left 1039504731 8:38043732-38043754 CCAGCAGCTTCATAAGACCCCTG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1039504742 8:38043770-38043792 TGGGATCTTGGTTCTCTTTGTGG No data
1039504731_1039504741 3 Left 1039504731 8:38043732-38043754 CCAGCAGCTTCATAAGACCCCTG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1039504741 8:38043758-38043780 CCTGAGAAATGTTGGGATCTTGG No data
1039504731_1039504737 -4 Left 1039504731 8:38043732-38043754 CCAGCAGCTTCATAAGACCCCTG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1039504737 8:38043751-38043773 CCTGGCCCCTGAGAAATGTTGGG No data
1039504731_1039504735 -5 Left 1039504731 8:38043732-38043754 CCAGCAGCTTCATAAGACCCCTG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1039504735 8:38043750-38043772 CCCTGGCCCCTGAGAAATGTTGG No data
1039504731_1039504744 25 Left 1039504731 8:38043732-38043754 CCAGCAGCTTCATAAGACCCCTG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1039504744 8:38043780-38043802 GTTCTCTTTGTGGAGGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039504731 Original CRISPR CAGGGGTCTTATGAAGCTGC TGG (reversed) Intronic
901864634 1:12096596-12096618 CAGGGGTCTTATCTCACTGCAGG - Intronic
902583887 1:17426265-17426287 AAGGGGCCTGATGGAGCTGCTGG - Intronic
902618464 1:17636822-17636844 CTGAGGTCTTATGAAGCCCCAGG - Intronic
903952181 1:27002262-27002284 CTGGTGTCTTAGGTAGCTGCAGG + Intergenic
904362491 1:29985698-29985720 GAGAGGTCTCATGAAGCTTCAGG - Intergenic
913236057 1:116784431-116784453 CAGGGGGCTTAAGAAGAGGCTGG + Intergenic
913480634 1:119285837-119285859 CAGGGGGCATATGAAACTGTTGG + Intergenic
913614035 1:120538423-120538445 CAGGGGACTTAGGAAGATGCAGG + Intergenic
914373930 1:147055394-147055416 CGGGGGACTTAGGAAGATGCAGG + Intergenic
914432102 1:147628194-147628216 TAGGGGTCTTATGAAGGAGGCGG + Intergenic
914576233 1:148972470-148972492 CAGGGGACTTAGGAAGATGCAGG - Intronic
915286613 1:154857377-154857399 CAGGGGTTTGCTGAAGCTCCAGG - Intronic
915935841 1:160089868-160089890 CAGGGGGCTTATGAAAGGGCAGG - Exonic
918178763 1:182068160-182068182 CAGGGGCATGATGAAGCTGTTGG + Intergenic
921680999 1:218030845-218030867 CAGGGGCTTCATGGAGCTGCAGG + Intergenic
1063490970 10:6463560-6463582 CAGGGATTTTAAGAAGCTGGCGG + Intronic
1063755718 10:9005314-9005336 CAGGGGTTTTTAGAAGCTGAAGG + Intergenic
1063818239 10:9802206-9802228 CAGGGTTTTTATGAAGATGTTGG + Intergenic
1065416600 10:25495026-25495048 CAGTAGTTTTCTGAAGCTGCAGG + Intronic
1066375736 10:34856483-34856505 AGGGGTTCTTATGATGCTGCAGG - Intergenic
1068146360 10:53075940-53075962 CAGAGGGCATATGAAGCTGTTGG + Intergenic
1075437883 10:122458995-122459017 CAGGGGTATTAAGTAGCTGGGGG + Intergenic
1075875983 10:125806006-125806028 CAGGGGCCTAATTAAGCTCCAGG + Intronic
1076858834 10:133130111-133130133 CAGGGGCCCTGTGAAGCTGCAGG - Exonic
1077147425 11:1052395-1052417 CAGGGGTCACAAGAAGCTGGTGG - Intergenic
1077554634 11:3220140-3220162 CGGGGGTCGGAGGAAGCTGCAGG - Intergenic
1077864616 11:6211879-6211901 CAGGGGTATCATGAAGGTGCTGG + Intronic
1078665353 11:13320381-13320403 CATGGGTCTGATGAAGCTGAGGG - Intronic
1080958538 11:37130442-37130464 CAGGAGTCTACTGAAGGTGCAGG + Intergenic
1082794622 11:57370214-57370236 CAGGGGTCCTAGGAAGCAGATGG - Exonic
1082933909 11:58637186-58637208 AAGAGGTCTTATGAAGCCTCAGG - Intergenic
1084501278 11:69536948-69536970 CAGGGGTCTTCTGAAGGTTATGG + Intergenic
1090250606 11:125248235-125248257 CAGGGTTCTAATGAACCTGAAGG + Intronic
1095196907 12:39329963-39329985 CAGGGGGTTTATGAAACTGGAGG + Intronic
1095979365 12:47962458-47962480 GAGGGGTCTGATGAAGCCTCTGG + Intergenic
1099644545 12:85335476-85335498 CAGGGGATTTATGTAGCTTCTGG + Intergenic
1100793393 12:98154671-98154693 CAGGAGAATTCTGAAGCTGCCGG + Intergenic
1104887710 12:132120476-132120498 GAGGCGTCTGCTGAAGCTGCAGG + Intronic
1108774352 13:53746106-53746128 CAGGGATCTTATTAAGCACCTGG - Intergenic
1110450131 13:75631580-75631602 CTGGGGTCTGCTGAGGCTGCAGG - Intronic
1110904001 13:80862636-80862658 CAGCTGTCTTATGAAACAGCAGG + Intergenic
1112388170 13:98959445-98959467 CAGAGGTCTTCAGCAGCTGCTGG + Intronic
1114059574 14:19007119-19007141 CAGGGGTCATATGGCACTGCAGG + Intergenic
1114060096 14:19010262-19010284 CAGGGGTCGTATGGCACTGCAGG + Intergenic
1114060391 14:19012033-19012055 CAGGGGTCGTATGGCACTGCAGG + Intergenic
1114061118 14:19016447-19016469 CATGGGTCGTATGACACTGCGGG + Intergenic
1114101138 14:19383532-19383554 CATGGGTCGTATGACACTGCGGG - Intergenic
1114101962 14:19388573-19388595 CAGGGGTCGTATGGCACTGCAGG - Intergenic
1114102450 14:19391509-19391531 CAGGGGTCGTATGGCACTGCAGG - Intergenic
1114102972 14:19394632-19394654 CAGGGGTCATATGGCACTGCAGG - Intergenic
1118377019 14:65186250-65186272 CAAGAGGCTTATGAAGCTGTTGG + Intergenic
1118745905 14:68773079-68773101 CAGGGAACTTGGGAAGCTGCAGG - Intergenic
1118754138 14:68826047-68826069 CATGGGGCTTGTGTAGCTGCAGG - Intergenic
1119800668 14:77442210-77442232 CAGGGTTATTATGAAGATGAAGG - Intronic
1122470875 14:101965049-101965071 CAGGGGTCATCTGCAGCTGCCGG - Intronic
1125730300 15:41889224-41889246 CAGGGGTCTTGTGTGTCTGCAGG - Intronic
1129361855 15:75029362-75029384 GTGGGGTCTTGTGAAGTTGCTGG + Intronic
1129928135 15:79384426-79384448 GAGGGGCCTTATGCAGCTGGGGG + Intronic
1131999566 15:98165139-98165161 CTGGGGTCTTTAGCAGCTGCAGG - Intergenic
1132088396 15:98926879-98926901 CAGGAATATTATGAAGCTTCTGG - Intronic
1133318086 16:4896291-4896313 GAGAGTTCTTAAGAAGCTGCGGG - Intronic
1134596888 16:15502802-15502824 CATGGGTCTGTTGGAGCTGCGGG + Intronic
1135423827 16:22322590-22322612 CAGGGGTCTTAGGATGAGGCTGG + Intronic
1136765312 16:32771457-32771479 CAGGGGCCATGTGAAGATGCAGG - Intergenic
1136802787 16:33098927-33098949 CAGGGGCCATGTGAAGATGCAGG + Intergenic
1138503866 16:57466512-57466534 CAGGGGCCTTAGGATGCTACAGG + Intronic
1139365745 16:66432517-66432539 CAGGGGTTTCATGGATCTGCGGG - Intronic
1139384064 16:66552815-66552837 CGGGAGGCTGATGAAGCTGCTGG + Intronic
1141471205 16:84239881-84239903 CAGGGCTCTCCTGCAGCTGCTGG - Intergenic
1144875100 17:18393421-18393443 CAGGGGTTCTCTGAAGCTGTCGG + Intergenic
1145157124 17:20551000-20551022 CAGGGGTTCTCTGAAGCTGTCGG - Intergenic
1146659084 17:34652743-34652765 CAGGGGCCTTATGCTGGTGCTGG - Intergenic
1148245617 17:46028024-46028046 CAGAAGTTTTATGAAGCTGCAGG - Exonic
1148511569 17:48175116-48175138 CAGGTGTCATGAGAAGCTGCTGG - Intronic
1148778534 17:50109224-50109246 CAGGGGCCTCCTGGAGCTGCAGG - Intronic
1156221677 18:35059248-35059270 CAGAGCTCTCATTAAGCTGCAGG + Intronic
1160041780 18:75352136-75352158 CATGGGCCATATGAATCTGCTGG - Intergenic
1161930176 19:7334231-7334253 CAGGGTTCTTAAGAAACTGAAGG + Intergenic
1163208338 19:15820953-15820975 CTGAGCTCTTATGTAGCTGCAGG + Intergenic
1163949007 19:20566962-20566984 GAGAGGTCTTATGAAGCTTCAGG - Intronic
1163969075 19:20775122-20775144 AAGGAGTCTCATGAAGCTTCAGG + Intronic
1166469863 19:43070990-43071012 CAGCGGTTGTATGAAGCTGTGGG - Intronic
925623629 2:5819737-5819759 CACTGGTCATATGTAGCTGCAGG - Intergenic
925990344 2:9249704-9249726 CACGGGTCTCCTGGAGCTGCAGG + Intronic
928215352 2:29356782-29356804 CAGGGCTCTTGTGCAGCTGCAGG + Intronic
929124261 2:38508947-38508969 CACAGGTCTCTTGAAGCTGCCGG - Intergenic
932038613 2:68274501-68274523 CAGAGGCTTTATGATGCTGCTGG - Intergenic
936922494 2:117703105-117703127 CATGGGTCTTATTTAGATGCTGG + Intergenic
938281359 2:130065790-130065812 CAGGGGTCATATGACACTGTGGG - Intergenic
938331894 2:130453912-130453934 CAGGGGTCGTATGACACTGTGGG - Intergenic
938357781 2:130665942-130665964 CAGGGGTCGTATGACACTGTGGG + Intergenic
938358115 2:130667927-130667949 CAGGGGTCATATGACACTGCAGG + Intergenic
938478491 2:131636811-131636833 CATGGGTCATATGACACTGCAGG + Intergenic
941249031 2:163138810-163138832 CAGCAGGCTTATGAACCTGCTGG - Intergenic
946246315 2:218389756-218389778 CAGGGGACTTAAGAAGGTACTGG + Intronic
1170188362 20:13618017-13618039 CAGGCCTCTTGTGCAGCTGCAGG - Intronic
1170814499 20:19701644-19701666 CAGGGGTCTGATGAACCCGTTGG + Intronic
1170874183 20:20235124-20235146 CAGGAGTCAGATGCAGCTGCGGG - Intronic
1171388569 20:24786592-24786614 AAGGGGTCTCAGGAAGCAGCTGG - Intergenic
1172476215 20:35239871-35239893 CACAGGTCATATGAGGCTGCTGG + Intronic
1175945215 20:62555450-62555472 CTGGGGTCTTAGGCAGCGGCTGG + Intronic
1176602187 21:8803576-8803598 CAGGGCTCATATGACACTGCGGG - Intergenic
1177391199 21:20475248-20475270 TAGGGGTCTTTTGAAACAGCTGG - Intergenic
1178938502 21:36884873-36884895 CAGGGGTCTCAGGAAGGTGTGGG + Intronic
1179525726 21:41974708-41974730 CTGGGCTCTTACGAAACTGCAGG - Intergenic
1179988564 21:44933977-44933999 CTGGGGGCTTATGAAACTGCAGG + Intronic
1180344472 22:11695127-11695149 CAGGGCTCATATGACACTGCGGG - Intergenic
1180478577 22:15732874-15732896 CAGGGGTCGTATGGCACTGCAGG + Intergenic
1180478872 22:15734645-15734667 CAGGGGTCGTATGGCACTGCAGG + Intergenic
1180479601 22:15739059-15739081 CATGGGTCGTATGACACTGCGGG + Intergenic
1183449968 22:37888000-37888022 CAGGGCTGTTATGATCCTGCAGG - Intronic
1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG + Intronic
1183999225 22:41660064-41660086 CAGGGGACTTCTGATGCAGCAGG + Intronic
951808220 3:26670596-26670618 CAAGGGTTTTATTAAGCTGGAGG + Intronic
952327351 3:32333452-32333474 CAGGGGTCTTGTTAAAATGCAGG - Intronic
954698136 3:52438268-52438290 CAGGGGTCTCAGGAAGCTGAGGG - Intronic
955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG + Intergenic
955413148 3:58668813-58668835 CAGCTGTGTTATGAAGCTGCTGG - Intergenic
956405010 3:68919064-68919086 CAGTGGACTTGGGAAGCTGCAGG - Intronic
956409001 3:68959308-68959330 GTGGGGGCTTAAGAAGCTGCTGG - Intergenic
957327254 3:78712060-78712082 CAGGGTTCTTTTTAAGATGCTGG + Intronic
959782280 3:110248506-110248528 CAGGAGTTTTATGATGCTGCTGG - Intergenic
961986162 3:131137432-131137454 GAGGGAGCTGATGAAGCTGCTGG - Intronic
967319100 3:188178106-188178128 CAGGGCTCTGATGGAGCTCCTGG + Intronic
973718718 4:53702544-53702566 CTGGGGTCTCCTGAGGCTGCAGG + Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
979883193 4:125988394-125988416 CAGAGGTGTGATGAAACTGCTGG - Intergenic
982472804 4:155814102-155814124 CAGTGGTCTCATGAAGCTAGTGG + Intergenic
985299657 4:188474675-188474697 CTGGTGTCTTCGGAAGCTGCAGG - Intergenic
987754019 5:22076915-22076937 CAGGGCACTTATGAACCTGTAGG - Intronic
989116067 5:37953484-37953506 CTGGAGTCTTCTGAACCTGCTGG + Intergenic
992500794 5:77340899-77340921 GAGGGCTCTTAAGAAGGTGCAGG + Intronic
995037644 5:107553197-107553219 CAGGGGCCTTATTAAACTGTGGG + Intronic
998996900 5:147875868-147875890 CAGGGGTCTCAGGAATCTCCTGG + Intronic
999278334 5:150347275-150347297 CAGGGGTGTTATGAGGCTGGAGG - Intergenic
999649481 5:153751184-153751206 CAGGGTTCAGATGAAGCTGAAGG - Intronic
999873433 5:155775810-155775832 CAGGGAGCTTATGATGCTACAGG + Intergenic
1000221457 5:159218427-159218449 GTGGGGTCTGATGCAGCTGCTGG + Intergenic
1006502126 6:34465872-34465894 CAGGGGTCGGCTGAAGCAGCGGG + Intergenic
1008685233 6:53919076-53919098 CAGGGCTGGTGTGAAGCTGCAGG - Intronic
1008813511 6:55534615-55534637 CAGGGGGCTTGGGCAGCTGCAGG - Intronic
1014312293 6:119819124-119819146 CCTGGGTCTTAGGAAGCAGCAGG + Intergenic
1018867600 6:167758379-167758401 CAGGGGTCTGAAGGAGCTGCCGG - Intergenic
1023815258 7:43944392-43944414 AAGGGGTCTGATGCAGATGCAGG - Intronic
1024131361 7:46355735-46355757 CAGGGGTGTTATGAATTTGTGGG + Intergenic
1024140291 7:46456101-46456123 CAGGGCTCTAATCAAGCTGCTGG + Intergenic
1024546691 7:50528431-50528453 AAGGGGTCTCATGAAGGTGCAGG - Intronic
1026871343 7:73854214-73854236 CAGGGGTCTTGTTATGCTGTAGG + Intergenic
1028475291 7:91246986-91247008 CAGTAGTCTACTGAAGCTGCTGG + Intergenic
1032078373 7:128846704-128846726 CACTGGTCTTATGAAGCTGATGG + Intronic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1036656796 8:10682085-10682107 CAGGGGTCTTGAGAGGCTGGAGG - Intronic
1039504731 8:38043732-38043754 CAGGGGTCTTATGAAGCTGCTGG - Intronic
1040985549 8:53290487-53290509 CAGTGGGCATATGAATCTGCTGG - Intergenic
1041764483 8:61404077-61404099 GAGGATTCTTATGGAGCTGCTGG + Intronic
1043745234 8:83867005-83867027 GAGGGGTCATAAGAAGATGCAGG - Intergenic
1045273438 8:100680970-100680992 CAGGGGGCTCCTGAAGCAGCTGG - Intergenic
1048006725 8:130425542-130425564 CATGGGTCTCATGAAGCTCATGG + Intronic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1049534833 8:143174300-143174322 TAGGGTTCTTATGAAGCTGAAGG + Intergenic
1052889801 9:33687756-33687778 CAGGGGTCCCATGAAGGAGCAGG + Intergenic
1185850825 X:3484905-3484927 CAGGTGTCTCATGAAGTTGCAGG + Intergenic
1190878126 X:54474381-54474403 CAGGGGCCTAGGGAAGCTGCTGG - Intronic
1192167158 X:68833324-68833346 CAGGGGACTTTAGGAGCTGCTGG - Intronic
1198015756 X:132609073-132609095 CATGGGGTTTATGAAACTGCAGG + Intergenic
1200359904 X:155593307-155593329 CTGAGGTCATATGAGGCTGCTGG - Intronic