ID: 1039506349

View in Genome Browser
Species Human (GRCh38)
Location 8:38055162-38055184
Sequence CGTGAGATGCTGAAGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039506349_1039506353 6 Left 1039506349 8:38055162-38055184 CCTCTGCCCTTCAGCATCTCACG 0: 1
1: 0
2: 0
3: 19
4: 248
Right 1039506353 8:38055191-38055213 TCAGCACAGAGCCCCGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039506349 Original CRISPR CGTGAGATGCTGAAGGGCAG AGG (reversed) Intronic
900920606 1:5667906-5667928 TGTGAGACGCTGGAGTGCAGGGG - Intergenic
900920640 1:5668038-5668060 TGTGAGATGCTGGAGTGCAGGGG - Intergenic
901465428 1:9418099-9418121 AGAGAGATGCTGATGGGAAGAGG - Intergenic
903185211 1:21624943-21624965 CCTGAGATGCTCAGGGGAAGAGG + Intronic
903620449 1:24694309-24694331 GATGAGATGGTGAAGGGCAAAGG - Intergenic
903663256 1:24991468-24991490 CGTGAGCTCCTAGAGGGCAGGGG + Intergenic
903707300 1:25295687-25295709 AGAGAAAGGCTGAAGGGCAGGGG + Intronic
903768227 1:25748294-25748316 CCTGGGAAGCTGAAGGGGAGCGG + Intronic
904162963 1:28534976-28534998 AGTGAAATCCAGAAGGGCAGTGG - Intronic
904258063 1:29269549-29269571 CGTGTAATTCAGAAGGGCAGGGG - Intronic
904550733 1:31315119-31315141 CGTGAGTTACTGTAGAGCAGAGG + Intronic
904730895 1:32590312-32590334 GGTGAGATACTGAAGCCCAGTGG - Intronic
906300734 1:44679903-44679925 TGTGAGTTCCTCAAGGGCAGGGG - Intronic
906537538 1:46560015-46560037 CTTAAGGTGCTGGAGGGCAGAGG + Intronic
906561131 1:46757777-46757799 CCTGAGCTGCCAAAGGGCAGGGG + Intergenic
910176610 1:84437598-84437620 GGTGAGAAGTTGAAGGACAGTGG + Intergenic
912497130 1:110098800-110098822 AGTGGGGTGCTGATGGGCAGAGG + Intergenic
916592528 1:166206274-166206296 GGGGAGGTGCTGAAGGGTAGGGG + Intergenic
917692953 1:177487724-177487746 CCTGGGATGCTGAAGAGGAGTGG - Intergenic
919753187 1:201050962-201050984 GGTGAGATGCTGAGGGCCTGCGG - Exonic
920786164 1:209043546-209043568 TGTGAGATCCTTAAGGGCAGAGG + Intergenic
922153373 1:223023144-223023166 AGTGAGAGGCTGCAGGGCTGGGG - Intergenic
922910392 1:229210923-229210945 GTTGAGATGGTGGAGGGCAGAGG - Intergenic
1063826494 10:9904373-9904395 TGTGTGATTCTGAAGGGGAGAGG - Intergenic
1063941583 10:11135357-11135379 CGTGAAATAGTGGAGGGCAGAGG + Intronic
1064236219 10:13578210-13578232 CGCTTGATCCTGAAGGGCAGAGG + Intergenic
1065805186 10:29387559-29387581 CGTGGGATGCTAAACTGCAGAGG + Intergenic
1069889403 10:71643870-71643892 AGTGAGCCTCTGAAGGGCAGGGG + Intronic
1070813977 10:79311945-79311967 CCTCTGATGCTGCAGGGCAGAGG - Intronic
1071800600 10:89055706-89055728 TGTGAGATCCTCAAGGGAAGTGG + Intergenic
1075524196 10:123168957-123168979 CGTCAGATGCTCTAGGGCAGGGG - Exonic
1076375169 10:129978879-129978901 CCAGAGGTGGTGAAGGGCAGTGG + Intergenic
1076671793 10:132124920-132124942 GGTGACATGCAGATGGGCAGTGG - Intronic
1076715147 10:132360133-132360155 CGAGACAGGCTGAAGTGCAGTGG + Intronic
1076738157 10:132467922-132467944 CGTGAGGGGCTGCAGGTCAGAGG - Intergenic
1077300762 11:1846004-1846026 CGTGAGGGGGTGAAGGTCAGGGG - Intergenic
1077334756 11:1998288-1998310 GGTGGGGTGCTGAGGGGCAGAGG + Intergenic
1080727065 11:34909010-34909032 CGAAAGAGGCTGAAAGGCAGTGG + Intronic
1082008911 11:47437573-47437595 AGTGAGAAGCTGACGTGCAGTGG - Intergenic
1083344433 11:61979483-61979505 TGTGAGATGGGGCAGGGCAGGGG - Intergenic
1083344686 11:61981045-61981067 TGTGAGATGCGGCAGGGCAGGGG - Intergenic
1083661574 11:64253925-64253947 CAAGGGATGCAGAAGGGCAGTGG + Intronic
1083728668 11:64641810-64641832 GGTGAGATGCTGGGGGTCAGAGG + Intronic
1084289851 11:68155616-68155638 CTGGAGGTGCTGGAGGGCAGCGG - Exonic
1084656875 11:70524844-70524866 CATGAGATGGTGAGAGGCAGCGG - Intronic
1084662363 11:70553585-70553607 CGTGAGGTGCAGGAGTGCAGTGG + Intronic
1086257817 11:84900054-84900076 TGTAAGATACTGAAGGTCAGAGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1090206022 11:124884905-124884927 CAGGAGAAGCTGAAGGACAGTGG + Exonic
1090243646 11:125200904-125200926 CGTGTGATCCTCATGGGCAGGGG + Intronic
1090665267 11:128911119-128911141 CGTGAAATCCTCAAGGGCAGGGG - Intronic
1090749748 11:129735075-129735097 CGTAAGATCCTGAAGAGAAGAGG + Intergenic
1091148690 11:133305024-133305046 CATGAAAAGCTGCAGGGCAGGGG - Intronic
1202817739 11_KI270721v1_random:53470-53492 GGTGGGGTGCTGAGGGGCAGAGG + Intergenic
1091408410 12:223295-223317 CGTGTGAAGCTAAAGGGCATAGG - Intronic
1091802106 12:3330864-3330886 CTTGAGATGCTGAATGGCATGGG - Intergenic
1094697682 12:32837176-32837198 CTTGAGACTATGAAGGGCAGGGG + Intronic
1095741512 12:45611460-45611482 CGTGGGATGCTGAAGATCTGAGG + Intergenic
1096122218 12:49095443-49095465 TGGAAGCTGCTGAAGGGCAGTGG + Intergenic
1097732612 12:63146661-63146683 ACTGAGATGCTGAAGGTGAGAGG - Exonic
1100611061 12:96192918-96192940 TGTGAGCTGCTAAAGGGCACGGG - Intergenic
1102812645 12:115837761-115837783 CCTGAATTGCTGGAGGGCAGAGG + Intergenic
1105439423 13:20402991-20403013 GGTGACCTTCTGAAGGGCAGGGG + Intergenic
1106217412 13:27715522-27715544 AGTGACCTGCTGAAGGGGAGAGG + Intergenic
1106247524 13:27962203-27962225 AGTGATATGGTGAAGGGAAGTGG - Exonic
1107838613 13:44433419-44433441 AGTAAAATCCTGAAGGGCAGTGG - Intronic
1108065970 13:46577933-46577955 TGGGGGATGCAGAAGGGCAGTGG + Intronic
1108598721 13:51972462-51972484 GCTGAGATGCTGGAGGACAGTGG - Intronic
1109476574 13:62887066-62887088 GGTGAGGTGCTGACGGGCATAGG + Intergenic
1110126478 13:71949444-71949466 TGAGATATGGTGAAGGGCAGAGG - Intergenic
1113883930 13:113647447-113647469 CATGCCATGCTGAAGGTCAGAGG - Intergenic
1113949824 13:114065731-114065753 GGTCAGAGGCTGGAGGGCAGGGG + Intronic
1114450410 14:22821915-22821937 CGCGAAAGGGTGAAGGGCAGGGG + Intronic
1115882844 14:37939559-37939581 GGTGAGCTCCTCAAGGGCAGTGG + Intronic
1117091982 14:52260859-52260881 CGTGAGTCTCTCAAGGGCAGGGG - Intergenic
1117581757 14:57158206-57158228 TGTGAGTTGTTGAAGGACAGGGG + Intergenic
1118513025 14:66497080-66497102 GCTAAAATGCTGAAGGGCAGGGG + Intergenic
1118850242 14:69577515-69577537 AGTGAGAGGCTGGAGTGCAGTGG - Intergenic
1119819677 14:77604243-77604265 GGAGAGAGTCTGAAGGGCAGTGG + Intronic
1124136829 15:27042569-27042591 CGGGACATGGTGGAGGGCAGGGG - Intronic
1124904036 15:33851675-33851697 CGAGTGATGCTGAAGGGCCAAGG - Intronic
1127318223 15:57817458-57817480 GGGGAGATGCTGAAGTGTAGCGG - Intergenic
1129300434 15:74622449-74622471 CATGAGAATCTGGAGGGCAGGGG - Intronic
1129909421 15:79213679-79213701 TGTGAGCTTCTGGAGGGCAGGGG + Intergenic
1131419712 15:92295092-92295114 CCTGAGTTGATGTAGGGCAGGGG + Intergenic
1131935234 15:97496967-97496989 GGGGAGGTGCTGAAGGGCAGTGG - Intergenic
1132480777 16:165196-165218 TGTGGGAGGGTGAAGGGCAGGGG - Intronic
1133062912 16:3186903-3186925 CCTGTCAGGCTGAAGGGCAGTGG + Intergenic
1133208215 16:4246852-4246874 CGGGAGATGCTGGAGGACACAGG + Intergenic
1133515441 16:6504330-6504352 TGTCTGATGGTGAAGGGCAGGGG - Intronic
1133736321 16:8618746-8618768 CGTGATATGCTGATGGGAGGCGG + Intergenic
1134311457 16:13078845-13078867 GTGGAGATGCTGCAGGGCAGTGG + Intronic
1134461973 16:14437344-14437366 GGTGGGCAGCTGAAGGGCAGAGG + Intronic
1135032770 16:19051794-19051816 CGTGATATGCTGATTGTCAGAGG - Exonic
1135990485 16:27216009-27216031 GGTGAGACGGTGAGGGGCAGAGG - Intronic
1137470240 16:48747967-48747989 TATGAGCTCCTGAAGGGCAGGGG + Intergenic
1137514102 16:49127596-49127618 TGTGAGATGGGGCAGGGCAGGGG + Intergenic
1138023234 16:53503188-53503210 CGGGAGATGCTGTCGGGCCGCGG - Exonic
1138351566 16:56348766-56348788 GGGGAGATCCTGCAGGGCAGGGG - Intronic
1138643694 16:58407049-58407071 CGTGAGAGGAGGAAGGTCAGGGG - Intergenic
1138970196 16:62134163-62134185 CCTGAGGTGGTGCAGGGCAGTGG + Intergenic
1141395708 16:83702657-83702679 CATGAGATGCTCAAGGTCGGTGG + Intronic
1141762206 16:86036051-86036073 CCTGAGATGCTGACGGCCTGAGG - Intergenic
1142348377 16:89568627-89568649 AGAGACACGCTGAAGGGCAGGGG - Intergenic
1142658830 17:1413455-1413477 GGTCAGATGCTGATTGGCAGGGG - Intergenic
1142905314 17:3037231-3037253 AGTGAGAGGCTGTGGGGCAGCGG + Exonic
1143294355 17:5859617-5859639 AGTGGGAGGCGGAAGGGCAGTGG + Intronic
1144232969 17:13227703-13227725 CCTGAGTTACTGAAGGGCATGGG + Intergenic
1145961313 17:28888008-28888030 CGTGAGCTGCTGACGGGTGGGGG + Intronic
1146085227 17:29822162-29822184 CTGGAGATGCTGAAGGGGATGGG - Intronic
1147158676 17:38558557-38558579 GGTGGGATGGCGAAGGGCAGGGG + Intronic
1148440254 17:47708512-47708534 GGTGAGATGGGGCAGGGCAGGGG + Exonic
1149468637 17:56898923-56898945 CGTGCAATGCTGATGGACAGCGG + Intronic
1151863152 17:76781264-76781286 CGTAGCATGATGAAGGGCAGAGG - Intronic
1151906446 17:77052493-77052515 CGTGAGACACTGGAGTGCAGTGG - Intergenic
1151942031 17:77298713-77298735 AATGAGATGCAGAAAGGCAGGGG - Intronic
1152241867 17:79165148-79165170 AGGAAGATGCTGGAGGGCAGAGG - Intronic
1152350220 17:79780065-79780087 CTTGAGATGTTCAAGGGCAAGGG + Intronic
1152811409 17:82384438-82384460 CCAGAGCTGCTGCAGGGCAGTGG + Intergenic
1155651808 18:28152376-28152398 CTTGAGCTCCTTAAGGGCAGGGG - Intronic
1156470993 18:37377182-37377204 CCTGAGATGCAGGAAGGCAGTGG + Intronic
1157291312 18:46411895-46411917 AGTGAGAGGAGGAAGGGCAGGGG + Intronic
1158689841 18:59650415-59650437 CGTGAAAAGCTGAAGGGAACAGG - Intronic
1160049320 18:75417275-75417297 CTTCAGATGTTAAAGGGCAGTGG + Intronic
1161390145 19:4016453-4016475 CTTCAGAGGCTGAAGGGCACAGG - Intronic
1162084508 19:8240472-8240494 CGTGACATGCTGGAAGGAAGGGG - Intronic
1163726756 19:18927570-18927592 CGTGAGACTCTGAAAGACAGCGG + Intronic
1167904041 19:52643732-52643754 CGTGAGAGACTGACAGGCAGAGG + Intronic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168444992 19:56404155-56404177 GGTGGGATTCTGAAGGCCAGCGG + Intronic
926216764 2:10910768-10910790 TGTGAGATGTTGATGCGCAGGGG - Intergenic
927646979 2:24884064-24884086 TGTGAGAGGCTGTAGGGAAGAGG - Intronic
928273973 2:29881994-29882016 ACTGAGCTGCTGAAGGGCTGAGG - Intronic
928313529 2:30229982-30230004 CGGGAGATGCTGCAGGGATGGGG - Intergenic
929252941 2:39779322-39779344 CGTGTGATGCCAAAGGGGAGAGG + Intergenic
932407847 2:71525770-71525792 TGTATGGTGCTGAAGGGCAGGGG - Intronic
932570392 2:72935477-72935499 TTTGAGGTGCTGAGGGGCAGGGG - Intronic
932798342 2:74716929-74716951 GGTGAGATGGGGAGGGGCAGAGG - Intergenic
934775571 2:96935000-96935022 TGTGAGTTACAGAAGGGCAGGGG - Intronic
935354469 2:102186365-102186387 TGTGATAGGCTGAAGGTCAGTGG - Intergenic
937056753 2:118943965-118943987 CAAGAGATGATGAGGGGCAGTGG + Intronic
937117834 2:119421447-119421469 CTTGAGATGGTGCAGGGAAGTGG + Intergenic
938041788 2:128082244-128082266 CTGGAGAGGCTGAAGTGCAGTGG + Intergenic
938067251 2:128287813-128287835 CAGGAGAGTCTGAAGGGCAGTGG - Intronic
939588794 2:144037528-144037550 GAGGAGATGCTGAAGGGCATGGG + Intronic
940043338 2:149384023-149384045 TGTGAGCTGCTCAAGGGTAGAGG + Intronic
940285743 2:152031650-152031672 CGGGAGGGGCTGATGGGCAGGGG - Intronic
944573470 2:201068548-201068570 CGTAAAATTCTGAAGGGAAGTGG + Intronic
945630206 2:212265160-212265182 TGTGAGCTTCTCAAGGGCAGGGG - Intronic
946025598 2:216670042-216670064 GCTGAGGTGCTGCAGGGCAGGGG + Intergenic
948417781 2:237827308-237827330 CCTCAGATACTGAAGGGCAGAGG - Exonic
948587375 2:239027869-239027891 CGGGAGCTGCTGAAGGCCACCGG - Intergenic
948627738 2:239279563-239279585 GGTGAGGAGCAGAAGGGCAGGGG + Intronic
1168973930 20:1949965-1949987 TGTGAGATGGGGAAGGCCAGTGG - Intergenic
1169269410 20:4187715-4187737 AGAGAGAAGCTGAGGGGCAGGGG - Exonic
1169844240 20:9972376-9972398 CGTAAATTGCTGAAGGGCATCGG - Intergenic
1171151488 20:22830235-22830257 AGTGTGATGCTGAAGAGGAGTGG - Intergenic
1171188642 20:23142262-23142284 AGCCAGATGCTCAAGGGCAGAGG + Intergenic
1171489226 20:25504792-25504814 CATGAGTGGCTGAAGGGTAGAGG + Intronic
1171774128 20:29349968-29349990 CGTGAGCCGCTGGAGTGCAGGGG + Intergenic
1171774143 20:29350034-29350056 CGTGAGCTGCTGGAATGCAGGGG + Intergenic
1173847614 20:46197950-46197972 CCTGGGATCCTGATGGGCAGAGG + Intronic
1174838318 20:53878538-53878560 GTTGAGATGGTGAAGGGAAGAGG + Intergenic
1175225705 20:57442694-57442716 CCTGAGCTGCAGAGGGGCAGAGG - Intergenic
1175568420 20:59999590-59999612 GGTCAGATGTTGAAGGCCAGAGG + Exonic
1176430745 21:6573994-6574016 CCTGAGCTCATGAAGGGCAGAGG + Intergenic
1176674800 21:9768104-9768126 CCTGAGCTTCTGAAGGGCTGAGG + Intergenic
1178167060 21:29991283-29991305 TGGGAGATGCTGTAGGGGAGGGG + Intergenic
1178734206 21:35134202-35134224 TGTGTGTAGCTGAAGGGCAGGGG + Intronic
1179061696 21:37985051-37985073 CTTGAGATGCTGCAGGGAACGGG - Intronic
1179070832 21:38069264-38069286 CGTGAGCTCCACAAGGGCAGAGG + Intronic
1179658751 21:42861520-42861542 CGAGAGATGGTGAAGGGGAGGGG + Intronic
1179706139 21:43181456-43181478 CCTGAGCTCATGAAGGGCAGAGG + Intergenic
1180335615 22:11574486-11574508 CATGAGCTGCTGAAGTGCAGGGG - Intergenic
1181640043 22:24191508-24191530 AGTGGGAGGCTGGAGGGCAGGGG - Intergenic
1182914405 22:34015757-34015779 GGTGAGATGCTGAAGAGGACTGG + Intergenic
1182988400 22:34742814-34742836 CGTGAGAGACTGAGGGGCAGAGG + Intergenic
1183104371 22:35605889-35605911 AGACAGATGCTCAAGGGCAGGGG + Intergenic
1183359716 22:37377123-37377145 TGCAAGATGCAGAAGGGCAGGGG + Intronic
1183664329 22:39238719-39238741 TGTGTGATGCTGAGGGCCAGTGG - Intronic
1185265740 22:49903049-49903071 CGTGTGATGCTGCTGGGCACTGG - Exonic
1185359566 22:50397529-50397551 CTTGGGATGCTGGGGGGCAGGGG + Intronic
1185380020 22:50503978-50504000 CGTGAGGAGCTGAGGAGCAGGGG - Intronic
949777963 3:7653105-7653127 AAGGAGATGCTGGAGGGCAGAGG - Intronic
950285633 3:11742624-11742646 CCTGTTATGCTGGAGGGCAGTGG + Intergenic
950491418 3:13307327-13307349 CGTGAGCTAATGAATGGCAGTGG + Intergenic
950549844 3:13659580-13659602 CGTGGGATGCTGAGGAGCAGTGG + Intergenic
952415085 3:33082755-33082777 CGTGTGATACAGCAGGGCAGTGG - Intronic
953451455 3:43009902-43009924 AGTGAGTTGCTGGGGGGCAGGGG + Intronic
954196640 3:49001102-49001124 AGAGTGATCCTGAAGGGCAGAGG - Intronic
954668914 3:52277704-52277726 CGCGGGAAGCTGAGGGGCAGGGG + Intronic
959130777 3:102353640-102353662 CCTGAGATGTTTTAGGGCAGGGG - Intronic
962270796 3:133976736-133976758 TTTGAGATGTTGAAGGGCAGGGG - Intronic
963824181 3:149933162-149933184 CTTAAGATGGTGCAGGGCAGAGG + Intronic
967432833 3:189407021-189407043 CCACAGAGGCTGAAGGGCAGTGG - Intergenic
967540045 3:190656549-190656571 CGTGAAATGATGAAGAGCAAGGG - Exonic
971232104 4:24808379-24808401 CGTGAAAACCTGAAGGGGAGAGG - Exonic
972646914 4:40977202-40977224 TGCTAGATGCTGAAGGGCAGTGG + Intronic
973114110 4:46433534-46433556 AGGGAGATTCTGAAGGGAAGAGG + Intronic
974788753 4:66657455-66657477 TTTGAGATGCTGTAGTGCAGTGG - Intergenic
975869899 4:78768493-78768515 CTTGAGATGCAGAAGGACAGCGG + Intergenic
976222455 4:82768489-82768511 AGTGAGTTAGTGAAGGGCAGAGG + Intronic
977064847 4:92302552-92302574 CTTGAGATGGTGAAGGAGAGTGG + Intronic
977324030 4:95552382-95552404 CTTGAGAGGCTGAAGAGGAGAGG - Intergenic
978340541 4:107717916-107717938 TGTGAGGGGCTGAAGGGCTGGGG - Intronic
979729141 4:124001390-124001412 GGTGATATGCTCAAGAGCAGAGG + Intergenic
980200095 4:129645452-129645474 AGTGAGATACTGAAGAGAAGAGG - Intergenic
985041197 4:185893457-185893479 AGTGAGGTGCTGAAGGGCCCGGG - Intronic
985313586 4:188630936-188630958 AATGAGATGCAGAAGGGCACTGG + Intergenic
985966626 5:3342941-3342963 CCTGAGATGCTGAGGGGCTCTGG - Intergenic
991435588 5:66595142-66595164 CATAAGCTGCTCAAGGGCAGGGG + Intergenic
995524018 5:113036406-113036428 AGTGAGATGCGTAAGGGCACAGG - Intronic
995714425 5:115068302-115068324 AGTGAGATGGTTAAGGGCATAGG - Intergenic
996957562 5:129202397-129202419 CGTTAAATGGTGAAAGGCAGAGG + Intergenic
1002045252 5:176537766-176537788 CCTGAGATACTGAAGTGCAATGG + Intronic
1003303840 6:4908780-4908802 TGTGAGAAGCTGCAGGGCAGAGG - Intronic
1003363368 6:5450149-5450171 TGTGAGCTGCAGGAGGGCAGGGG - Intronic
1011238294 6:85242213-85242235 CCTGAGACCCTGAATGGCAGTGG + Intergenic
1012069696 6:94597851-94597873 CGTGAGATGGTTAATGGCAATGG - Intergenic
1013457107 6:110340212-110340234 CCTGGGTTGCTGAGGGGCAGGGG + Intronic
1013758676 6:113490471-113490493 TGAGGGATGCTGAGGGGCAGTGG - Intergenic
1013813932 6:114075304-114075326 GGTGAGATTCTGAAGTGCAGCGG - Intronic
1014486259 6:122002834-122002856 CGTGTCAGGCAGAAGGGCAGTGG - Intergenic
1015166864 6:130208350-130208372 CGTGAAATGCTGTAGGACAGGGG + Intronic
1017273054 6:152531656-152531678 TGGTAGAGGCTGAAGGGCAGAGG - Intronic
1017530330 6:155284011-155284033 TCTGAGATGCTGAAGGGAGGTGG + Intronic
1018227983 6:161648149-161648171 CTTGAGATGCCCAAGGACAGTGG + Intronic
1020033049 7:4946434-4946456 CCAGTGATGCTGAAGGGAAGTGG + Intronic
1020261080 7:6531124-6531146 CGGCAGGTGCCGAAGGGCAGGGG + Intronic
1021630939 7:22646817-22646839 GGTGAGAGGATGAAGTGCAGTGG + Intergenic
1022877804 7:34552944-34552966 GGTGAGATGCTGGAGGGATGGGG - Intergenic
1024281903 7:47725310-47725332 TGAGTGATGCTGAAGGGCATGGG + Intronic
1027223766 7:76231463-76231485 CCTGAGCTCCTGGAGGGCAGAGG - Intronic
1027234053 7:76287329-76287351 CGGGAGATTCAGGAGGGCAGCGG + Intergenic
1030108199 7:106004736-106004758 CCAGAGAAGCAGAAGGGCAGAGG - Intronic
1034453762 7:151152851-151152873 AGTGGGATGCTGAGCGGCAGGGG + Intronic
1034710411 7:153186028-153186050 CCTGAGATTGTGCAGGGCAGTGG + Intergenic
1035470865 7:159107742-159107764 CTGGAGCTGCTGCAGGGCAGGGG + Intronic
1035930721 8:3777229-3777251 CATGAGCTCCTTAAGGGCAGGGG + Intronic
1038491578 8:27975747-27975769 CCTGGGATGCAGCAGGGCAGAGG - Intronic
1038874363 8:31532013-31532035 GATAAGATACTGAAGGGCAGGGG - Intergenic
1039506349 8:38055162-38055184 CGTGAGATGCTGAAGGGCAGAGG - Intronic
1041179927 8:55236662-55236684 CGAGAGATGCAGGAGGGTAGAGG - Intronic
1042055161 8:64756634-64756656 TGTGAGATGCTAGCGGGCAGGGG - Intronic
1045270781 8:100659303-100659325 CTGGAGAGGCTGGAGGGCAGTGG - Intronic
1046983721 8:120364253-120364275 CATGAGATGCCTGAGGGCAGTGG - Intronic
1047207899 8:122818156-122818178 CGTCAAATGCTGCAGGGCATTGG + Intronic
1048012425 8:130468793-130468815 CGTGAGCTCCTCAAGGGCAAAGG - Intergenic
1049165964 8:141126735-141126757 CGTGACTTCCTGAGGGGCAGTGG - Intronic
1049407661 8:142458833-142458855 CTTGGGAAGCTGAGGGGCAGTGG + Intronic
1049744595 8:144257880-144257902 TGTGAGGTGCTCGAGGGCAGCGG + Intronic
1056948906 9:91026204-91026226 TGTGAGGTCCTGAGGGGCAGTGG - Intergenic
1057050235 9:91917969-91917991 CATTAGAAGCTGAAGGGCACAGG + Intronic
1057241773 9:93417537-93417559 CAAGAGATGCTAAAGGGAAGTGG - Intergenic
1057393384 9:94657966-94657988 GCTGAGGTGCTGAAGTGCAGTGG + Intergenic
1057910682 9:99017707-99017729 GGTGAGGTGCAGAAGAGCAGGGG - Intronic
1058802952 9:108562542-108562564 TGTGAGCTCCTTAAGGGCAGGGG - Intergenic
1058906410 9:109485752-109485774 CGTGAGCTGCTCCAGGACAGAGG - Intronic
1060232535 9:121836347-121836369 TGTGAGATTCTGAAGGGCATGGG + Intronic
1060534977 9:124378537-124378559 CGAGGGCTGCTGAAGGGTAGTGG - Intronic
1062361792 9:136191702-136191724 CGTGAGAGGCTGCAGTGCTGTGG - Intergenic
1186767064 X:12781803-12781825 GGAGAGAAGCTGAAGGTCAGTGG + Intergenic
1189299725 X:39943759-39943781 CGGGAGTCACTGAAGGGCAGTGG + Intergenic
1192600548 X:72459175-72459197 CGTGAGATTTTGGAGGGCACTGG + Intronic
1197841314 X:130750054-130750076 AGTGAGATGCAGACAGGCAGAGG - Intronic
1199389703 X:147264470-147264492 AGTCAGATTCTGTAGGGCAGTGG - Intergenic
1199997285 X:153033215-153033237 CCTGACATCCTGCAGGGCAGTGG + Intergenic
1200219280 X:154383221-154383243 CTTGGGATGGTGAGGGGCAGAGG - Intergenic