ID: 1039512678

View in Genome Browser
Species Human (GRCh38)
Location 8:38104563-38104585
Sequence CAATATCTACGTATTTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039512677_1039512678 -10 Left 1039512677 8:38104550-38104572 CCAATTGGGAAATCAATATCTAC No data
Right 1039512678 8:38104563-38104585 CAATATCTACGTATTTCCCATGG No data
1039512675_1039512678 4 Left 1039512675 8:38104536-38104558 CCAATAATTGAGAACCAATTGGG No data
Right 1039512678 8:38104563-38104585 CAATATCTACGTATTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039512678 Original CRISPR CAATATCTACGTATTTCCCA TGG Intergenic
No off target data available for this crispr