ID: 1039512795

View in Genome Browser
Species Human (GRCh38)
Location 8:38105232-38105254
Sequence CTGGATATTCTGCGCAGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039512795_1039512799 21 Left 1039512795 8:38105232-38105254 CCTCTTCTGCGCAGAATATCCAG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1039512799 8:38105276-38105298 GCGTCAGTCCCTGACTCGAAAGG 0: 1
1: 0
2: 0
3: 1
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039512795 Original CRISPR CTGGATATTCTGCGCAGAAG AGG (reversed) Exonic
900677260 1:3895480-3895502 CTGGCTTTTCTCTGCAGAAGGGG - Intronic
903963324 1:27070908-27070930 CTGGATCTCCTGGGCAGAAGCGG + Intergenic
908282226 1:62552346-62552368 CTGGATATTTTTTGGAGAAGAGG + Intronic
908471751 1:64451053-64451075 TTGGATATTCAGCACTGAAGAGG + Intergenic
908495382 1:64689187-64689209 CTGCAAATTCAGGGCAGAAGAGG - Intronic
909185670 1:72482223-72482245 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
917593222 1:176498810-176498832 CTGGAAATGCTGGTCAGAAGTGG + Intronic
919651461 1:200153487-200153509 CAGGATATTATGCACAGTAGGGG + Intronic
922076814 1:222253470-222253492 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
922335447 1:224615678-224615700 TGGGCTATTCTGCGCTGAAGAGG - Intronic
923770195 1:236931546-236931568 ATGGATAATGTGCCCAGAAGAGG + Intergenic
924937848 1:248787418-248787440 CTGGATATTCATCTCAGAACTGG - Intergenic
1068720394 10:60238865-60238887 CTGGATATTGTGTGTAGGAGGGG - Intronic
1068904478 10:62307616-62307638 ACGGAAATTCTGGGCAGAAGAGG - Intergenic
1072279161 10:93850586-93850608 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1074684787 10:115950476-115950498 CTGGTTATTTTTGGCAGAAGTGG + Intergenic
1077266549 11:1653543-1653565 CTGGATTCTCTGAGCAGAAGTGG - Intergenic
1080502596 11:32885122-32885144 CGGGAAATTCTGCGTAGAAGAGG + Intergenic
1088166219 11:106940851-106940873 TTGGATATTCTGTGAAGAATGGG - Intronic
1092436246 12:8449035-8449057 CTGAATATTCAGGGAAGAAGAGG + Intergenic
1097041590 12:56159114-56159136 CCTGATATTCTGTGCAGATGGGG + Intronic
1097451619 12:59744110-59744132 AGGGAAATTCTGAGCAGAAGAGG + Intronic
1100224629 12:92543674-92543696 CTGGAGAGACTGCACAGAAGAGG + Intergenic
1101432769 12:104640813-104640835 AGGGAAATTCTGGGCAGAAGAGG + Intronic
1103628596 12:122240784-122240806 TTGAATATTCTGTGCAGAATTGG - Intronic
1105639681 13:22249643-22249665 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1106396044 13:29381977-29381999 CTGGAAACTCTGCTCAGAACGGG + Intronic
1108487637 13:50942975-50942997 AGGGAAATTCTGGGCAGAAGAGG - Intronic
1110246006 13:73325331-73325353 CTGCTTATTCTGTGAAGAAGAGG + Intergenic
1111104721 13:83629939-83629961 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1111235875 13:85406542-85406564 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1114574539 14:23700196-23700218 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1114574551 14:23700260-23700282 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1119188393 14:72661408-72661430 CTGGGTATTCTGGTCAGCAGAGG - Exonic
1119612410 14:76074789-76074811 CTGGATCTTCAGCAAAGAAGGGG - Intronic
1121171050 14:91854780-91854802 CTGAATATTCTGAGGAGTAGGGG + Intronic
1122641629 14:103163441-103163463 GGGGAAATTCTGGGCAGAAGAGG + Intergenic
1122643276 14:103175045-103175067 AAGGAAATTCTGGGCAGAAGAGG + Intergenic
1123765209 15:23471170-23471192 AAGGAAATTCTGGGCAGAAGAGG - Intergenic
1125262943 15:37848266-37848288 CTGGAAGATCTGCGCAGCAGAGG - Intergenic
1127678892 15:61273352-61273374 CTGGTACTTCTGCGCATAAGAGG + Intergenic
1128321321 15:66696705-66696727 CTGGAGGTTCTGAGCAGAAAAGG - Intergenic
1134311075 16:13075587-13075609 CTGGATTTGCTGAGCAGGAGCGG + Intronic
1140805775 16:78530708-78530730 AGGGAAATTCTGGGCAGAAGAGG - Intronic
1141248095 16:82329583-82329605 CTGGATTTTCTGCGCTTAAAGGG - Intergenic
1144163148 17:12581516-12581538 AGGGAAATTCTGGGCAGAAGTGG + Intergenic
1147230120 17:39011646-39011668 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1159002452 18:62986557-62986579 GTGGATATTCTGCCTAGAAACGG - Intergenic
1159030587 18:63226400-63226422 AGGGAAATTCTGGGCAGAAGAGG - Intronic
1159090246 18:63840132-63840154 CAAGATATTTTGCACAGAAGCGG - Intergenic
1164527354 19:29022061-29022083 CTGTATATCCTGTTCAGAAGGGG + Intergenic
1165300799 19:34967528-34967550 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1165872489 19:38982778-38982800 CTGGATAATTTTGGCAGAAGGGG + Intergenic
1166265548 19:41682028-41682050 CTCGACATTCTGGGCTGAAGTGG + Intronic
1166561828 19:43737716-43737738 CTGATTAGTCTGGGCAGAAGAGG - Intronic
927254986 2:21033394-21033416 CTGGATATTTTGCTCAGAGATGG + Exonic
928257014 2:29731520-29731542 CTGGAGATTCTGGGCAGCATCGG + Intronic
929332346 2:40698005-40698027 CTGGATATTCAGCAAAGAAGAGG + Intergenic
931458608 2:62431856-62431878 AGGGAAATTCTGGGCAGAAGTGG + Intergenic
933165406 2:79069905-79069927 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
933772370 2:85752735-85752757 CTGGAGATTCTGGAAAGAAGGGG - Intronic
937891255 2:126940601-126940623 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
938150759 2:128880313-128880335 AGGGAAATTCTGAGCAGAAGAGG - Intergenic
938787833 2:134648511-134648533 AGGGAAATTCTGGGCAGAAGAGG - Intronic
941796316 2:169602805-169602827 CTGGCTATTTTGTGCAGAAGAGG + Intronic
943917507 2:193655149-193655171 CTGGAACTTCTGACCAGAAGAGG + Intergenic
944748346 2:202681773-202681795 AGGGAAATTCTGGGCAGAAGAGG + Intronic
946216012 2:218184097-218184119 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
948216405 2:236236714-236236736 CTGGATGTCCTGCCCAGCAGGGG - Intronic
1172093923 20:32451554-32451576 CAGGCTACTCTGCGCAGATGGGG - Intronic
1175746517 20:61460707-61460729 CTGGCTGTTCTGCAGAGAAGGGG + Intronic
1175805469 20:61826135-61826157 CTGGGAGTTCTGAGCAGAAGGGG - Intronic
1176965160 21:15204610-15204632 CTGGTTATTCTTCTCAGATGGGG + Intergenic
1177703780 21:24674180-24674202 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1177800648 21:25825384-25825406 CTGTATATTTTGCTCAGTAGAGG + Intergenic
1178223626 21:30689392-30689414 AGGGACATTCTGGGCAGAAGAGG + Intergenic
1178447307 21:32658081-32658103 AGGGAAATTCTGGGCAGAAGTGG + Intronic
1179602157 21:42486592-42486614 CAGGATTTCCTGAGCAGAAGGGG - Intronic
1180881120 22:19204153-19204175 CTGGACATTTTGAGCAGAGGAGG - Intronic
1180890904 22:19288080-19288102 GTGGATATGCTGGGCAGAGGAGG - Intronic
1181112788 22:20611708-20611730 CTGGCTATGCTGGGCCGAAGGGG - Intergenic
1181310459 22:21941941-21941963 CTGGCTTTTCTGGGCAGAAGGGG + Intronic
1182092495 22:27605411-27605433 CTGGACATGCTGGGAAGAAGAGG + Intergenic
1182626093 22:31647429-31647451 CTTAATATTCTGGGCAAAAGAGG - Intronic
1183229203 22:36570400-36570422 CTGGCTCTTCTGTGCCGAAGAGG - Intronic
1183347372 22:37315273-37315295 ATGGATTTTCTGGGCATAAGTGG + Exonic
1183788320 22:40044916-40044938 CTCCATAGTCTGCGGAGAAGCGG + Intronic
950476790 3:13219871-13219893 CTGGATATTGTGGGCAGCAGTGG - Intergenic
954563596 3:51579406-51579428 AGGGAAATTCTGGGCAGAAGAGG - Intronic
957414186 3:79879022-79879044 CAGGAAATTCTGGGCAGAAGAGG - Intergenic
958466825 3:94470022-94470044 CAGGAAATTCTGGGCAGAAGAGG - Intergenic
958467390 3:94474027-94474049 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
959376489 3:105594111-105594133 ATGGAAATTCTGGGGAGAAGAGG - Intergenic
977827547 4:101551693-101551715 AGGGAAATTCTGGGCAGAAGAGG + Intronic
979596562 4:122541467-122541489 AGGGAAATTCTGTGCAGAAGAGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
980495393 4:133584054-133584076 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
982084739 4:151822671-151822693 CTGGCTAATCTGGGCAGATGAGG - Intergenic
982786681 4:159544397-159544419 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
983987235 4:174073873-174073895 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
985752985 5:1693035-1693057 CGGGAAATTCTGGGTAGAAGAGG - Intergenic
986406589 5:7431850-7431872 AGGGAAATTCTGGGCAGAAGAGG + Intronic
986959377 5:13194875-13194897 CAGGACATTCTGAGCTGAAGTGG - Intergenic
990128350 5:52547998-52548020 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
990469703 5:56103899-56103921 GTGGATGGTCTGTGCAGAAGCGG + Intronic
991000470 5:61777621-61777643 GAGGATATTCTGCCCAGACGGGG - Intergenic
993007898 5:82447977-82447999 GTGGAAATTCTGAGCAAAAGAGG - Intergenic
993171457 5:84424894-84424916 CTGGACATTCTGAGCAGGAAAGG - Intergenic
993999565 5:94762589-94762611 CTGTCTATTCTGAGCAGAATGGG + Intronic
994188137 5:96838179-96838201 CAGGAAATTCTGGGCAGAAGAGG - Intronic
995284312 5:110369120-110369142 TGGGAAATTCTGGGCAGAAGTGG - Intronic
996101567 5:119450328-119450350 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
996502204 5:124229953-124229975 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
997569265 5:134913642-134913664 CTGGCTGTTCTGCTCAGAATAGG + Intronic
997766938 5:136514123-136514145 CTGGATCTTCTAAGAAGAAGAGG - Intergenic
998617597 5:143757663-143757685 ATGCATATTCTTTGCAGAAGAGG - Intergenic
998644043 5:144042530-144042552 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1003792559 6:9563091-9563113 ATAGATCTTCTGAGCAGAAGCGG - Intergenic
1005363429 6:25054012-25054034 AGGGAAATTCTGCGCAGAAGAGG - Intergenic
1009524725 6:64729208-64729230 AGGGAAATTCTGGGCAGAAGAGG - Intronic
1011899593 6:92275436-92275458 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1011988728 6:93484399-93484421 TTGGAAATTCTGTGCTGAAGAGG + Intergenic
1013492399 6:110660936-110660958 AGGGAAATTCTGGGCAGAAGAGG - Intronic
1014276371 6:119394594-119394616 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1016183170 6:141171541-141171563 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1016549011 6:145255875-145255897 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1019400688 7:851395-851417 CTGCAGATTCTGCGCAGGATCGG + Exonic
1020284166 7:6667491-6667513 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1020739136 7:11990707-11990729 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1021092643 7:16501706-16501728 AGGGAAATTCTGGGCAGAAGAGG + Intronic
1021808324 7:24378609-24378631 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1022531267 7:31068428-31068450 CTGCATTTGCTGCTCAGAAGAGG + Intronic
1026001033 7:66558827-66558849 CTGGATCTTCTGGGCAGGAAAGG + Intergenic
1026919446 7:74144458-74144480 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1026987795 7:74565573-74565595 CAGGATATGCTGGGAAGAAGCGG + Intronic
1027378863 7:77583324-77583346 CTGGATATGGTGCACAGAATAGG - Intronic
1031439062 7:121770564-121770586 CTGGAGATACTGAGCAAAAGAGG + Intergenic
1031696121 7:124857342-124857364 AGGGAAATTCTACGCAGAAGAGG + Intronic
1033071815 7:138209778-138209800 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1033875786 7:145817321-145817343 AAGGAAATTCTGGGCAGAAGAGG + Intergenic
1034917343 7:155051771-155051793 GTGGAGATTCTGAGCAGAACAGG - Intergenic
1035361308 7:158315580-158315602 CTGGAGATTCTGCTCACAGGAGG - Intronic
1037427449 8:18771297-18771319 AGGGAAATTCTGGGCAGAAGAGG - Intronic
1039512795 8:38105232-38105254 CTGGATATTCTGCGCAGAAGAGG - Exonic
1040433693 8:47368596-47368618 ATGTCTTTTCTGCGCAGAAGTGG + Intronic
1041846716 8:62337281-62337303 CTGGATATTTTGCCCGGAAATGG + Intronic
1044553280 8:93535532-93535554 CTGGAGATTCTAGGCAGACGGGG - Intergenic
1044729796 8:95220589-95220611 CTGCATAGTCTGCGCAGCAGAGG - Intergenic
1046885604 8:119363690-119363712 CTGGATTTTCTTGGAAGAAGTGG + Intergenic
1047321939 8:123794769-123794791 CTGGAAATTCTCCCAAGAAGCGG + Intronic
1048603275 8:135941821-135941843 CAGGAGATTCTGGGAAGAAGGGG + Intergenic
1050944347 9:11499023-11499045 CAAGAAATTCTGGGCAGAAGAGG + Intergenic
1053545421 9:39018143-39018165 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1053809751 9:41839841-41839863 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1054620842 9:67347587-67347609 AGGGAAATTCTGGGCAGAAGAGG + Intergenic
1056282166 9:85052175-85052197 CTGGAAATTCTGGGCAGTGGAGG + Intergenic
1059210451 9:112509967-112509989 CTGGATTCTCTGAGCATAAGTGG + Intronic
1062543906 9:137053431-137053453 CTGGGTATTCAGCCCAGATGGGG - Intronic
1185880568 X:3736271-3736293 CAGGCTCTTCTGCGCAGAGGAGG - Intergenic
1186128677 X:6443094-6443116 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1186806677 X:13146704-13146726 CTGGATATTCTCAGGAGAAAAGG - Intergenic
1187144594 X:16626024-16626046 CGGGAAATACTGGGCAGAAGAGG - Intronic
1187359107 X:18607990-18608012 CTGTATATTATGCACAGAAAAGG - Intronic
1188554843 X:31399571-31399593 AGGGAAATTCTGGGCAGAAGAGG - Intronic
1189675088 X:43453184-43453206 AGGGAAATTCTGGGCAGAAGAGG - Intergenic
1190497072 X:51037084-51037106 CTTGATATGCTGTGCAAAAGTGG + Intergenic
1193886931 X:86994086-86994108 CTGGTTATTCTGGGCTCAAGGGG - Intergenic
1194631964 X:96296289-96296311 CTGGAGATTCTGCCCAGTGGGGG - Intergenic
1194957067 X:100193327-100193349 CAGGATATTTTGAGCAGATGTGG + Intergenic
1195721347 X:107871999-107872021 AGGGAAATTCTGGGCAGAAGAGG - Intronic
1196885017 X:120236190-120236212 CTGGATATTCTAGGCTGCAGTGG - Intergenic
1198525356 X:137494868-137494890 CTGGATGTTTTGAGCAGAAATGG - Intergenic