ID: 1039512816

View in Genome Browser
Species Human (GRCh38)
Location 8:38105356-38105378
Sequence CCCGCGGCCACCGCCGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 406}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039512807_1039512816 -1 Left 1039512807 8:38105334-38105356 CCTCCACCTTCAGCCTGCCAGGC 0: 1
1: 0
2: 3
3: 88
4: 1107
Right 1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG 0: 1
1: 0
2: 6
3: 52
4: 406
1039512809_1039512816 -7 Left 1039512809 8:38105340-38105362 CCTTCAGCCTGCCAGGCCCGCGG 0: 1
1: 0
2: 2
3: 25
4: 247
Right 1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG 0: 1
1: 0
2: 6
3: 52
4: 406
1039512808_1039512816 -4 Left 1039512808 8:38105337-38105359 CCACCTTCAGCCTGCCAGGCCCG 0: 1
1: 0
2: 2
3: 26
4: 339
Right 1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG 0: 1
1: 0
2: 6
3: 52
4: 406
1039512804_1039512816 19 Left 1039512804 8:38105314-38105336 CCGCACTAACCATCTAGCTTCCT 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG 0: 1
1: 0
2: 6
3: 52
4: 406
1039512802_1039512816 30 Left 1039512802 8:38105303-38105325 CCTCCAGAGAGCCGCACTAACCA 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG 0: 1
1: 0
2: 6
3: 52
4: 406
1039512805_1039512816 10 Left 1039512805 8:38105323-38105345 CCATCTAGCTTCCTCCACCTTCA 0: 1
1: 0
2: 1
3: 38
4: 491
Right 1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG 0: 1
1: 0
2: 6
3: 52
4: 406
1039512803_1039512816 27 Left 1039512803 8:38105306-38105328 CCAGAGAGCCGCACTAACCATCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG 0: 1
1: 0
2: 6
3: 52
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039512816 Original CRISPR CCCGCGGCCACCGCCGGCGC GGG Exonic
901441387 1:9280441-9280463 CCCGCTGCCAGCGGCGGGGCGGG - Intergenic
901673100 1:10867296-10867318 CCGGCGGCCGCGGGCGGCGCGGG + Intergenic
901798220 1:11692416-11692438 CGCGGGGCCACCGGCGGTGCTGG - Intronic
902916833 1:19644540-19644562 CCCGCGGCCGCCGGACGCGCCGG - Intronic
903349721 1:22710640-22710662 CCCGGGGGCAGCGCGGGCGCTGG - Intergenic
903907486 1:26696765-26696787 GCTGCCGCCACCGCCGCCGCCGG - Exonic
903925138 1:26826635-26826657 CCCGCCGCCACCGCCCGCCGCGG - Intergenic
904039292 1:27575173-27575195 CCCGCCGCCGCCGCCGCCTCTGG + Intronic
904500076 1:30908391-30908413 CCCGGGGCCGCCCCCCGCGCGGG - Intronic
904517230 1:31065761-31065783 GCCGCTGCCACCGCCGGGGCCGG - Intronic
904642016 1:31938144-31938166 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
904837749 1:33349918-33349940 CCCGCGGCCGCCTCCGCCGGGGG + Intronic
905028948 1:34868790-34868812 CCCGCCCCCACCCCCGGCCCTGG - Exonic
905058624 1:35120800-35120822 GCCGCGGCCAGAGCCGGAGCAGG + Intergenic
906130709 1:43453711-43453733 CCCGCGGCCCGCACCCGCGCGGG + Exonic
906204394 1:43979334-43979356 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
906525461 1:46490834-46490856 CCCGCGGCCTCAGCCGGCGTGGG + Intergenic
906960923 1:50419101-50419123 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
907430053 1:54406369-54406391 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
908355808 1:63323923-63323945 GCCGCGGCCGCCGCCGCTGCCGG - Exonic
913161855 1:116152296-116152318 CCCGCCGCCTCCGCCCACGCTGG + Intergenic
914869162 1:151458950-151458972 CCCGCGGCCGCCCCTGCCGCGGG + Intronic
917348875 1:174056635-174056657 CCAGCGGGCCCCGCCGGCCCTGG - Intergenic
918282959 1:183023576-183023598 GCCGCCGCCACCGCCCGCGCCGG + Exonic
918365653 1:183805139-183805161 CGCGCTGCCCCCGCCGCCGCCGG - Intronic
918951996 1:191151523-191151545 CCCGCCGGCACCACCGGCTCTGG + Intergenic
921823166 1:219640816-219640838 CCTGCGGCCACCACTGGCTCAGG - Intergenic
922306979 1:224352738-224352760 CCCGCGGGCCCCGCCGGCCCTGG - Intergenic
923191776 1:231626899-231626921 CACGCCGCCGCCGCCGGCGGCGG - Exonic
924042605 1:239998051-239998073 CCCGCGGCCACCGCCGACCCGGG + Intergenic
924172419 1:241356684-241356706 GCCGCGGCGGCCGCCGGAGCCGG + Intronic
924289722 1:242524714-242524736 CCCGCCGCCGCCGCCGCCCCGGG - Intergenic
924436681 1:244048904-244048926 CCGGCCGCCGCCGCCGCCGCCGG - Intergenic
924754787 1:246931493-246931515 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1062774683 10:135446-135468 CCCGCGCCCGTCGCCGGCTCAGG + Intronic
1063504022 10:6580181-6580203 CCCGCGCCCCGCGCCGCCGCCGG - Intronic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1064274199 10:13891772-13891794 CCCGCCGCCGCCCCCGCCGCGGG + Intronic
1064354209 10:14603750-14603772 GTCACGGCCACCGTCGGCGCGGG + Intronic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1067091302 10:43266905-43266927 CGCGCGGCCGGCGCCGGCGGCGG + Intronic
1067436594 10:46283095-46283117 CCCGCGGCACCCTCCCGCGCGGG + Intergenic
1069673939 10:70233600-70233622 CACGTGGCTGCCGCCGGCGCTGG + Intronic
1071086821 10:81875229-81875251 CCCGAGCCCGCCGCCGCCGCCGG + Intergenic
1071997555 10:91162973-91162995 CGCCCCGCCCCCGCCGGCGCGGG + Intergenic
1072059737 10:91798468-91798490 CGCGCTGCCTCCGCCGCCGCGGG + Exonic
1072107764 10:92290800-92290822 CCCGACGCCACGGCCGGGGCCGG + Intronic
1073030177 10:100519642-100519664 CCCGCGGGCAGGGCAGGCGCGGG + Intronic
1073051656 10:100671120-100671142 CCCGCCGCCTCCGCCGGGGCCGG + Intergenic
1073137377 10:101227444-101227466 GCCGCCGCCACCGCCGGCTGTGG + Exonic
1073137678 10:101228868-101228890 CCCGCGGGCAGCTCGGGCGCCGG + Exonic
1074399055 10:113126786-113126808 CCCGCGGCCGGCGCGGGCCCTGG + Intronic
1074996357 10:118760410-118760432 CCAGCGGGCCCCGCCGGCCCCGG - Intergenic
1075334206 10:121597382-121597404 CCCGCAGCCGCCGTCGGCGCTGG - Intronic
1075753431 10:124792004-124792026 CGCACGGTCCCCGCCGGCGCAGG - Intergenic
1076554237 10:131311644-131311666 CCCGCCGCCGCCGTCAGCGCGGG - Exonic
1076638915 10:131901020-131901042 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076722087 10:132397163-132397185 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076750014 10:132537799-132537821 CCCGCAGCCGCCGCCGACTCAGG - Exonic
1076816398 10:132917090-132917112 CCCGTGGCCGCCGCTGGCTCTGG + Intronic
1076849931 10:133087840-133087862 CCCGCCGCCATCGCCCGCCCCGG + Intronic
1077956003 11:7020482-7020504 CCCGCAGCTCCCGCCCGCGCAGG - Exonic
1078063385 11:8062242-8062264 CCCGCGGCCCCCACCTGCCCAGG - Intronic
1078527288 11:12110669-12110691 CCCGCGGCCAGGGCCGAGGCAGG + Exonic
1079689406 11:23403535-23403557 CGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1081700146 11:45147365-45147387 CCCGCAGCAGCCCCCGGCGCGGG - Exonic
1081831512 11:46119973-46119995 CCCGCGGCCGCCGGCGGCGGGGG + Intronic
1083572799 11:63769090-63769112 CTCGCGGCCACCGCCCCCTCGGG + Intergenic
1083807495 11:65083833-65083855 CCCGCTGCCGCCGCCGGAGGAGG - Intronic
1083899803 11:65638145-65638167 CCAGCCGCCGCCGCCCGCGCTGG - Intronic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1084395034 11:68903941-68903963 GCCGAGGCCATCGCCGCCGCCGG - Exonic
1084546849 11:69818951-69818973 CCTGCAGCCGCCGCCGCCGCGGG - Exonic
1084793554 11:71489952-71489974 CCCGCTGCCAACGCTGGTGCAGG - Intronic
1085266795 11:75242142-75242164 CCCGCGGGCGCGGCGGGCGCGGG - Exonic
1085408391 11:76277497-76277519 CCCGCGGCCCCCGCCTGCCTGGG + Intergenic
1085454880 11:76660142-76660164 CCCGTGGCCACCTCCAGCCCAGG + Exonic
1086981062 11:93198010-93198032 TCGGCGGGCACCGCCGGCGAGGG + Intergenic
1087634546 11:100687594-100687616 CCGGCGGCCGCGGCGGGCGCTGG - Intergenic
1089243089 11:117098319-117098341 CCTGCTGCCTCCGCCCGCGCCGG - Exonic
1089543668 11:119206289-119206311 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1090204321 11:124876295-124876317 CCCGCGCCCACCTCCAGCCCGGG - Exonic
1091381819 12:66835-66857 CCCGCCGCCAGCCCAGGCGCAGG + Exonic
1091916164 12:4272929-4272951 CCCGCGGCCAGCGGCCACGCAGG - Intergenic
1092894874 12:13001425-13001447 CCCGCGGCCGCCACAGGCTCCGG - Intergenic
1094041036 12:26122316-26122338 GCCGCGGCTGCCGCCGGGGCGGG + Exonic
1096073574 12:48788943-48788965 CCCGCCGCCCCCGCGGGCTCCGG + Intronic
1096178647 12:49538995-49539017 CCCGCGCCCGCCGCCTGCACCGG - Intergenic
1096191340 12:49622235-49622257 CCCGCAGCCGCCGCCGCGGCAGG - Intronic
1096983739 12:55743398-55743420 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1097107698 12:56635033-56635055 CCCTCCGCCGCCGCCGGCCCAGG - Intronic
1097929629 12:65169837-65169859 CCCGCGGCCGCCGCCGCCGCTGG - Exonic
1102115990 12:110403404-110403426 CCCGGAGCCTCCGCTGGCGCCGG + Intronic
1102136863 12:110582939-110582961 GCCGCCGCCGCCGCCGGCCCTGG + Exonic
1103828731 12:123762219-123762241 CCCGCCGACGGCGCCGGCGCTGG - Intergenic
1104671974 12:130686750-130686772 CCCCAGGCCCCCGACGGCGCTGG - Intronic
1104748376 12:131223652-131223674 CCCTCGGCCACCGCCAGCCCTGG + Intergenic
1104841660 12:131828691-131828713 CCCGCGGAGACCCCCGGCTCCGG - Intronic
1104977740 12:132559861-132559883 CCCGCGCCCGCCGCCGGCCCGGG - Intronic
1105368583 13:19782994-19783016 CCCTCCGCCAAAGCCGGCGCCGG + Intronic
1105871157 13:24507069-24507091 CCCGCTGGCCCCGCCGGCCCCGG - Intronic
1106340067 13:28819696-28819718 GCCGCGCCCACCGCCTGCGGAGG + Intergenic
1106995048 13:35471270-35471292 CCCTCGGCCCCCGCCGGGCCGGG - Intronic
1107548964 13:41457735-41457757 CCCGCGGCCGCCGCGGCCGCAGG + Exonic
1108688945 13:52845897-52845919 GCCGCGGCGACCGCAGGCGGAGG + Exonic
1109854309 13:68107979-68108001 CCGGTGGGCACCGCCGGCCCGGG - Intergenic
1110119758 13:71866530-71866552 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1111951317 13:94711550-94711572 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1112183761 13:97109468-97109490 CCCCCGCCCACCCCCGGCGGTGG - Intergenic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1112290893 13:98143362-98143384 CCCGCGGGCGGCGGCGGCGCGGG - Intronic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1113378991 13:109786278-109786300 GGGGCGGCCACCGCCCGCGCCGG - Exonic
1113737652 13:112689943-112689965 CCCGCGGCCGCAGCCCCCGCCGG - Intergenic
1113742369 13:112720451-112720473 CCCGCGGCCACAGCAGACGAAGG - Intronic
1113902051 13:113802899-113802921 CCCGCTCCCACCGCAGGGGCCGG - Intronic
1114031266 14:18583152-18583174 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1114559629 14:23580694-23580716 CCAGCTGGCCCCGCCGGCGCTGG + Intergenic
1115651169 14:35403984-35404006 CCCGCGGCCCCGGCGGGCGCCGG + Intronic
1117183664 14:53217773-53217795 CCCGCCGGCACCGCCGGCCCGGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118607703 14:67515407-67515429 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1119759548 14:77141161-77141183 GCCGCAGCCCCCGGCGGCGCAGG - Intronic
1121050456 14:90816368-90816390 CCCGCCGCCGCCGCGGGCTCGGG + Exonic
1121252940 14:92513430-92513452 CCCGCGGTCGGCGCCGGCACAGG + Intergenic
1121546965 14:94769813-94769835 CCCGTGGCCCCCGGCGGCGCGGG - Exonic
1121667873 14:95686350-95686372 CCCGCCCCCACTGCCGGCCCGGG + Intergenic
1122183498 14:99971991-99972013 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1122231201 14:100306983-100307005 CCGGAGGCCACCGCCGCCGCGGG - Intergenic
1122544925 14:102517026-102517048 CCCGCAGCCTCCGCCGAAGCCGG + Intergenic
1122788378 14:104174276-104174298 CCCGCATCCACCGCCTGCGCAGG + Exonic
1122921788 14:104883330-104883352 CCGGGGGCCGCCGCTGGCGCAGG - Exonic
1123224006 14:106883323-106883345 CCAGCGCCCACTGCTGGCGCCGG - Intergenic
1123671603 15:22664666-22664688 CCCACGGCTGCCGCCGGAGCTGG + Intergenic
1124109323 15:26772500-26772522 CCCGCGCCCCGCGCCGGAGCTGG - Intronic
1124323642 15:28737891-28737913 CCCACGGCTGCCGCCGGAGCTGG + Intronic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1126767006 15:52019444-52019466 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1129108065 15:73322712-73322734 CCCGCTGCCACCCCCAGCCCTGG + Exonic
1129288001 15:74541220-74541242 CCGGGGGCCACAGCCGGGGCGGG - Exonic
1129410547 15:75348204-75348226 CCCGCGGCCGCCCCCGGGTCAGG - Intronic
1130317651 15:82810041-82810063 CCCGCGGCTGCCGCCGGAGCTGG + Exonic
1130411699 15:83653723-83653745 GACGCCGCCACCGCCGCCGCCGG - Intergenic
1130908599 15:88256345-88256367 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1131160615 15:90102494-90102516 CGCGCGGGCACCACCGGGGCGGG + Exonic
1132365104 15:101251510-101251532 CCCGCTGCCCCCGCCCGCGGAGG + Exonic
1132796593 16:1726850-1726872 CCCGGGGCCACAGCCGTTGCCGG + Intronic
1132812817 16:1809724-1809746 CCCGCGCCCACCACCTGCCCTGG + Intronic
1132838199 16:1965202-1965224 CCCGCGGCCACGGCCAAAGCCGG - Intergenic
1132932909 16:2467905-2467927 CTCTTGGCCACCGGCGGCGCTGG + Intergenic
1133156453 16:3880137-3880159 CCGGCCGCCGCCGCCGCCGCCGG + Exonic
1133201736 16:4207897-4207919 CCCGCGTCTGCCGCCAGCGCGGG - Intronic
1133784411 16:8963567-8963589 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1134065277 16:11224467-11224489 ACAGCTGCCACCGCCGGCCCTGG + Intergenic
1135240860 16:20806343-20806365 TCTGCGGCCAACGCCAGCGCTGG + Intronic
1136226502 16:28863897-28863919 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1136705983 16:32188289-32188311 CCAGGGCCAACCGCCGGCGCCGG + Intergenic
1136761929 16:32741116-32741138 CCAGGGCCAACCGCCGGCGCCGG - Intergenic
1136784286 16:32925525-32925547 CCCACAGCCCCCGCCGCCGCCGG - Intergenic
1136806171 16:33129272-33129294 CCAGGGCCAACCGCCGGCGCCGG + Intergenic
1136885498 16:33928281-33928303 CCCACAGCCCCCGCCGCCGCCGG + Intergenic
1137738498 16:50742349-50742371 CCCGCGGGCCCGGCCGGCTCGGG - Intronic
1138247622 16:55479275-55479297 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
1139335907 16:66231023-66231045 CCCTCGGCCACAGCCGCTGCAGG + Intergenic
1139534449 16:67562808-67562830 CCCGGCGCCAGCGCCGCCGCCGG + Intronic
1139615364 16:68085386-68085408 GTCGCCGCCACCGCCGCCGCGGG - Intronic
1141054613 16:80804012-80804034 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1141839493 16:86565773-86565795 CCCGTGGCCCAGGCCGGCGCCGG - Intergenic
1203064088 16_KI270728v1_random:1001432-1001454 CCAGGGCCAACCGCCGGCGCCGG - Intergenic
1203086943 16_KI270728v1_random:1189531-1189553 CCCACAGCCCCCGCCGCCGCCGG - Intergenic
1142762340 17:2050011-2050033 CGCGCGGACGGCGCCGGCGCGGG + Intergenic
1142762392 17:2050166-2050188 ACCGCGGACAGCGGCGGCGCAGG + Intergenic
1142847818 17:2690652-2690674 CCTGGGGCCCCCGCTGGCGCGGG + Exonic
1143584527 17:7844620-7844642 GCCGTGGCCACCGGCGGCTCTGG + Intronic
1143635658 17:8162686-8162708 CCCGCGGCCATCGCCCGAGCCGG + Intronic
1143750504 17:9023415-9023437 CCCGCGGCCCCACCCGCCGCCGG - Intronic
1144021186 17:11241129-11241151 GCCGCAGTCACCGCCGGCGGGGG + Intergenic
1144021349 17:11241651-11241673 GCCGCCGCCACAGCCGCCGCGGG - Exonic
1144781610 17:17811049-17811071 CACGCAGCCACCACCGGCCCGGG + Exonic
1144909914 17:18672512-18672534 ACCGCTGCCACCGCCGCAGCCGG - Intronic
1145912886 17:28552599-28552621 CCCCCGGCTCCAGCCGGCGCAGG - Exonic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1146183028 17:30709319-30709341 CCCTCGTCCACCGCCGCCGTCGG + Intergenic
1146371134 17:32266153-32266175 CCCGCAGCCGCCGCCGCCCCCGG + Intergenic
1146581160 17:34040016-34040038 CGGGCAGCCACCGCCGGCGCCGG + Intronic
1147144577 17:38477672-38477694 GCCGCAGCCCCCGCCGCCGCCGG - Exonic
1147144828 17:38478888-38478910 CCCACGGCCACAGCAGGCCCAGG - Intronic
1147307401 17:39573630-39573652 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1147393443 17:40123159-40123181 CTCGCGCCCACCGCCACCGCCGG + Intronic
1147653025 17:42072718-42072740 CGCGCCGCCCCCGCCGGCCCAGG + Intergenic
1147890595 17:43713973-43713995 CCCGCGCCCGCCCCCCGCGCCGG - Intergenic
1148698624 17:49575651-49575673 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1148864547 17:50621818-50621840 CTCCCGGCCACCCCCGGGGCTGG + Intronic
1149430614 17:56593723-56593745 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1149894751 17:60421394-60421416 CCAGCGGCCACCTCGGGCACAGG - Intronic
1150060506 17:62065110-62065132 CCCTCGGCGCCCGCCGGCCCCGG + Intronic
1150108605 17:62479130-62479152 CGGGCAGCCGCCGCCGGCGCCGG - Exonic
1150128447 17:62653370-62653392 CCCGCCCCCACCCCCGGGGCGGG + Intronic
1150137655 17:62704341-62704363 CGCGCGGCCACCCCCGACCCCGG - Intronic
1150840379 17:68601010-68601032 CCCGCGGTGGCAGCCGGCGCCGG - Exonic
1152049187 17:77959097-77959119 GCCGCCGCCGCCGCCCGCGCCGG + Intergenic
1152662718 17:81550420-81550442 CACGCGGCCACCCCCGCCACAGG + Exonic
1152824811 17:82458315-82458337 GCCGCGGCCTCCGCGGGCCCAGG + Intronic
1153201905 18:2655732-2655754 CCCGCGACCAGCGCCGCCGCCGG - Exonic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1154374914 18:13801093-13801115 CCCGTGGCCACTCCCTGCGCTGG + Intergenic
1155003305 18:21706615-21706637 CCGGCTGGCACCGCCGGCCCTGG + Intronic
1155392184 18:25349840-25349862 GCCGCGGCCGCCTCCAGCGCTGG + Intronic
1157529473 18:48409290-48409312 CCGGCGGACACCGGCGGCGAAGG - Intronic
1158435948 18:57435679-57435701 CCCGCCGCCCCCGCCGCCCCCGG + Exonic
1160025030 18:75209539-75209561 CCCGGGGCTGCCGCCGGCTCGGG - Intergenic
1160699179 19:497871-497893 GCCACGGCCACCACCGGCTCCGG - Exonic
1160706176 19:531370-531392 CCCGCGGCCCCGCCCCGCGCCGG + Intergenic
1160719305 19:590357-590379 CCCGCCTCCTCCGCCGGCCCCGG - Exonic
1160725378 19:615949-615971 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
1160825702 19:1079687-1079709 CCCGCCCCCACCGCAGGCGGAGG + Exonic
1160830995 19:1104788-1104810 CTCGCGGCCGCCGCCTGCCCCGG - Intronic
1160912077 19:1479129-1479151 CCCGCGGTCACCCCAGTCGCCGG + Intronic
1161031895 19:2061443-2061465 CGCGCGGCCGCCGCCGGGGAGGG - Intergenic
1161400708 19:4065464-4065486 GCCGCCGCCACCGCCGCCGCCGG - Intronic
1161483754 19:4523880-4523902 CCCTCGGCCAGCGCGGCCGCTGG + Exonic
1161550593 19:4910126-4910148 CCCACGCCCACCCCCGCCGCCGG - Intronic
1161703080 19:5805345-5805367 CCCCCGGGCACCGCGGGCCCAGG + Intergenic
1161911551 19:7198183-7198205 GCCGCCGCAACCGCCGGGGCCGG - Intronic
1162128519 19:8511851-8511873 CCCGCCGCCACCCCCGGCCCTGG - Exonic
1162903400 19:13808841-13808863 CCAGACCCCACCGCCGGCGCAGG + Exonic
1162954324 19:14090033-14090055 GCCGCAGCCACAGCCGCCGCCGG - Exonic
1162975766 19:14206449-14206471 CCCTCGTCCACCGCCGGCGTCGG - Intergenic
1163106327 19:15125028-15125050 CCCGCGGCCGCCGCCCCCGCTGG - Exonic
1163154473 19:15432491-15432513 GCCACCGCCACCGCCGCCGCGGG - Intronic
1163443758 19:17334645-17334667 GCCGAGGCCGCCTCCGGCGCCGG - Exonic
1163606982 19:18280985-18281007 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1163807251 19:19406449-19406471 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
1164597076 19:29537348-29537370 CCCGCAGCCACCTCCACCGCTGG - Intronic
1165420073 19:35718098-35718120 GCCGCGGCCCCCGCCCCCGCCGG - Exonic
1165879494 19:39032238-39032260 CCCGCAGCCACAGCCGGGCCTGG - Exonic
1166280296 19:41788058-41788080 ACCGAGGCCACCGCAGGGGCCGG - Intergenic
1166361250 19:42253866-42253888 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1166361411 19:42254277-42254299 CCCCGGGCCACCGGTGGCGCGGG + Intronic
1167125333 19:47545122-47545144 CTCCAGGCCACCGCCGGGGCCGG + Exonic
1168280887 19:55304816-55304838 CCCGACGCCACCGCCGGGGCTGG - Exonic
1168335154 19:55593144-55593166 CCCGCGGCCCAGGCCTGCGCTGG + Exonic
927357069 2:22186440-22186462 CCCGCGGGCCCCGCCGGCCCCGG + Intergenic
927472271 2:23385400-23385422 CCCGCGGCCGCCGCGGCTGCGGG + Exonic
927811764 2:26184422-26184444 CCCGCGGCCCCCGCGCTCGCTGG - Exonic
928606357 2:32947621-32947643 ACCGCCGCCGCCGCCGCCGCCGG + Exonic
928983218 2:37156918-37156940 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
928998841 2:37325275-37325297 CCGGCGGCCACCCCGGGGGCAGG - Intergenic
929188786 2:39120983-39121005 GCCGCCGCCACCGCCGCCGCCGG + Exonic
930782125 2:55233156-55233178 CCTGCGGCCGCCGCCCGCTCTGG + Intronic
931395916 2:61888448-61888470 CCCGCGGCCGCCGGCAGCCCCGG + Exonic
932420696 2:71599695-71599717 CCCACCGCCACCTCCAGCGCAGG - Intronic
932567358 2:72918153-72918175 GCCGCGGCCGCCGCGGGCGCGGG + Exonic
932625526 2:73293184-73293206 CCCGCGGCCACCGGCTACCCTGG - Exonic
932699995 2:73985455-73985477 CCCGCGCCCCTCGGCGGCGCGGG + Intergenic
932704191 2:74010421-74010443 CCCACAGCCACCACCGGCACAGG + Intronic
933666861 2:84971284-84971306 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
934736236 2:96691269-96691291 CACGCGCCCAGCGCCGGCGGCGG - Intergenic
935592736 2:104856229-104856251 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
935731065 2:106065461-106065483 CACGCGGCCCCCGCCGCCGGCGG + Intronic
936985723 2:118310175-118310197 CGCGCGGCCGCCGCCCGCGATGG + Intergenic
938273022 2:129992528-129992550 GCTGCCGCCGCCGCCGGCGCTGG - Intergenic
938443202 2:131353578-131353600 GCTGCCGCCGCCGCCGGCGCTGG + Intronic
939432658 2:142130785-142130807 CCTGCCGCCGCCGCCGCCGCCGG - Exonic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
942240824 2:173963765-173963787 GCCGGGGCCCCCGCCGCCGCCGG - Exonic
942241118 2:173964684-173964706 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
942890510 2:180981072-180981094 CTCGCGGACACCGGCGACGCGGG - Intronic
944273087 2:197804958-197804980 GCCGCCGCCACTGCCGCCGCTGG + Exonic
944831218 2:203535341-203535363 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
945225874 2:207530479-207530501 CCCGCCGCCGCCGCCGGGCCGGG + Intronic
946311329 2:218883902-218883924 CCGGCGCTCACCGCCGCCGCGGG + Intronic
946404106 2:219483670-219483692 CCCGCAGCAGCCGCTGGCGCAGG - Exonic
946431021 2:219627527-219627549 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
947506659 2:230713051-230713073 CGCGCAGCCGCCGCCGCCGCGGG + Exonic
947741700 2:232487733-232487755 CGCTCGGTCACCGCCGGCTCGGG - Exonic
948243306 2:236456680-236456702 CCCTCGGCCACTGCCAGAGCTGG + Intronic
1169244421 20:4015009-4015031 CGCGCGCCCACCGCCAACGCGGG + Intronic
1170756916 20:19212877-19212899 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1172474491 20:35226777-35226799 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1173741638 20:45406319-45406341 CCCGCGGCGGGCGCCCGCGCCGG - Intronic
1173778751 20:45735995-45736017 CCGGCCGGCACCGCCGGCCCTGG + Intergenic
1174287770 20:49484197-49484219 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
1175488955 20:59365723-59365745 CCCGCCGCCACAGCCGGAACTGG + Intergenic
1175847201 20:62065286-62065308 CCCGGGGCCGGGGCCGGCGCGGG + Exonic
1175870310 20:62206230-62206252 CCCGGGGCCAGCGCCGACCCGGG - Intergenic
1176283383 20:64327998-64328020 CCCGCCGCCACCCCAGGCGCAGG - Intergenic
1177011054 21:15730367-15730389 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1179511853 21:41878905-41878927 CCCGCGGCCAGGCCCAGCGCGGG - Intronic
1179563947 21:42234865-42234887 TCCGCCGCCACCGCCCGCGCCGG + Intronic
1179822008 21:43942510-43942532 CCAGTGGCCACCGCAGGGGCGGG - Intronic
1179989581 21:44940160-44940182 CCCGCGGCCGAGGCCGGCGGAGG - Exonic
1180087840 21:45516023-45516045 CCCGCGGCAGCCCCCGGCCCAGG - Exonic
1180110267 21:45644036-45644058 CCCCGGGCCGCCGCAGGCGCCGG - Intronic
1180201946 21:46229411-46229433 CCCGCCCCCACCCCCGGCCCCGG - Intergenic
1180455379 22:15510210-15510232 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1180614898 22:17120678-17120700 CCCGGGGCCCCCGACGGCCCCGG + Exonic
1181026854 22:20131826-20131848 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1181056314 22:20262034-20262056 CCTGTGGCCACAGCCGGCCCCGG - Intronic
1181057905 22:20268478-20268500 CCCGCGTCCCCGGCCGGCTCCGG - Exonic
1181831716 22:25565157-25565179 CCAGCTGCCCCGGCCGGCGCCGG + Intronic
1182420539 22:30246532-30246554 CGCGCAGCCACCGGAGGCGCTGG - Intronic
1183452816 22:37906111-37906133 CCCGCCGCCTCCGTCCGCGCCGG - Intronic
1183939522 22:41285570-41285592 CCCGGGGCCCCCGCGGGCGTGGG + Intronic
1184033989 22:41910076-41910098 CCCGCGGCAACCCCCGGCGCGGG - Exonic
1184036374 22:41920100-41920122 GCCCCGGCCACCACCGGCCCCGG - Intergenic
1184086789 22:42270361-42270383 CCCTCGGCCTCCGCCGGGGGCGG + Intronic
1184651834 22:45922831-45922853 CCCGCGGCCGCCTCCGGGCCTGG + Exonic
1184687392 22:46102787-46102809 CCCACAGCCACAGCCAGCGCAGG - Intronic
1184766865 22:46576843-46576865 CGCGCGGCCGCCGCCGGCCACGG - Intronic
1185259590 22:49854038-49854060 CCCGCGGACCGCGCCGGGGCCGG + Intronic
1203238464 22_KI270732v1_random:30911-30933 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
950610603 3:14124564-14124586 CCCGCGACCACGCCGGGCGCGGG - Intronic
951080301 3:18444721-18444743 CCTGCCGCCGCCGCCGCCGCCGG + Intronic
951208321 3:19947260-19947282 GCCGCCGCCGCCGCCGGCGCTGG - Exonic
951208324 3:19947266-19947288 TCCGCCGCCGCCGCCGCCGCCGG - Exonic
951981969 3:28575977-28575999 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
952744450 3:36764221-36764243 CCCGCAGCCGCCGCCGCCCCCGG - Intergenic
953027531 3:39153564-39153586 CCCGCCGCCGCCGCCGCTGCCGG - Exonic
953526157 3:43691344-43691366 GCCGCGGCCAGCTCCGTCGCCGG - Intronic
954378260 3:50205953-50205975 CCAGCGGGCACAGCGGGCGCAGG + Intronic
954615554 3:51967340-51967362 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
955239336 3:57165347-57165369 GCCGCGGCCACCGCCCACTCGGG - Exonic
955387610 3:58492063-58492085 GCCGCCGCCGCCGCCGTCGCCGG + Intergenic
955911574 3:63863959-63863981 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
956659485 3:71583797-71583819 GCCGCCGCCGCCACCGGCGCTGG - Intronic
958814674 3:98901952-98901974 CCCGCGGCCCCCGCCCGGCCCGG + Intergenic
966182199 3:177197561-177197583 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
968090613 3:195896147-195896169 CGCGAGGCCATCGCCGGCACAGG + Intronic
968319267 3:197750593-197750615 CCGGCAGCCATGGCCGGCGCCGG - Intronic
968433824 4:575201-575223 CCCGCCGGCCCCGCCGGCCCCGG + Intergenic
968477470 4:818843-818865 CCCGCGGCCAAGGACGGTGCTGG + Intronic
968674716 4:1871348-1871370 CCCGCCGCCGCCGCCGCAGCCGG - Intergenic
968697943 4:2041918-2041940 CCCGCGGCCAGCGCAGTCTCGGG + Intergenic
968701300 4:2059401-2059423 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
969715876 4:8867850-8867872 CCCCCGGCCGCAGCCGCCGCTGG - Exonic
970194633 4:13542431-13542453 CCCGCTGCCGCCCCCGCCGCCGG + Exonic
971195759 4:24471031-24471053 CCCGCCGCGCTCGCCGGCGCTGG - Intergenic
972321550 4:37977358-37977380 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
972725774 4:41745776-41745798 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG + Exonic
975683410 4:76897551-76897573 CCCGCGGCCGCCCCCAGTGCAGG - Exonic
977607197 4:98995493-98995515 CACGCAGGCACCGCCGGCGGGGG + Intergenic
978503502 4:109433676-109433698 TCGGCGGCCGCCGCGGGCGCGGG - Intergenic
981270747 4:142845728-142845750 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
981942415 4:150296903-150296925 CCCGCGCCCACCCCCACCGCCGG + Intronic
985493373 5:191841-191863 CCCGCAGCCGCCGGCGGCTCCGG - Exonic
985549160 5:524479-524501 CCCGCGGCCCCCTCCCGCCCCGG + Intergenic
986297116 5:6448804-6448826 GCCGCCGCCACCGCCGGGCCCGG - Exonic
986297120 5:6448810-6448832 CCCGCCGCCGCCGCCACCGCCGG - Exonic
986330464 5:6713471-6713493 GCCGCCGCCGCCGCCGCCGCAGG + Intergenic
986608219 5:9544662-9544684 CCCGAGGACGCCGCAGGCGCAGG + Intronic
986813659 5:11385160-11385182 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
988825299 5:34929659-34929681 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
990955145 5:61332804-61332826 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
991198120 5:63959821-63959843 CCCGGGGGCACCGCTGGCACGGG + Intergenic
991676557 5:69094287-69094309 GCCGCCGCCGCCGCCGGGGCCGG - Exonic
991676561 5:69094293-69094315 CCCAAGGCCGCCGCCGCCGCCGG - Exonic
996862880 5:128084514-128084536 CCCACTGCCGCCGCCGCCGCCGG - Exonic
997013381 5:129904559-129904581 GCTGCCGCCACCGCCGCCGCCGG + Exonic
997704071 5:135930501-135930523 CGCGGGGGCACCGCCGGCGGTGG + Intronic
999248192 5:150166714-150166736 CCCGCGGCCCCAGCCGAGGCGGG - Intergenic
999248391 5:150167301-150167323 ACCGCTGCCACCGCCGCCTCCGG - Exonic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1001563225 5:172683639-172683661 CCCGCGGCCCGCGTCGTCGCCGG + Exonic
1002666773 5:180831185-180831207 CCCGCCGCCGCCGCCGCCTCGGG + Intergenic
1002817236 6:692758-692780 CCCGCGGTCCCCACCTGCGCCGG - Intronic
1003049416 6:2766049-2766071 CCGGCGGCCGCCGCCGCGGCGGG + Exonic
1003624094 6:7727055-7727077 GCCGCGGCCGCCGCCGCCGGGGG + Exonic
1004395894 6:15246048-15246070 GCCGCCGCCGCCGCCGCCGCTGG + Intergenic
1006472660 6:34237335-34237357 CCCTCCGCCGCCGCCGCCGCGGG - Intronic
1006535556 6:34696404-34696426 CCCGAGGCCGCTGCCAGCGCTGG + Intronic
1008381872 6:50845965-50845987 CCAGCGGCCACCCGGGGCGCCGG + Exonic
1009378933 6:63006198-63006220 CCCCAGTCCATCGCCGGCGCCGG - Intergenic
1011643057 6:89433159-89433181 CCCGCCGCGTCCGCCGCCGCAGG - Intronic
1012450636 6:99349765-99349787 CCGGCCGCCTCCGCCGGGGCCGG + Intronic
1013106144 6:107028176-107028198 CCCGCCCCTTCCGCCGGCGCCGG - Intergenic
1013117469 6:107114442-107114464 CTCCCGGCCGCCGCCGCCGCGGG + Intronic
1013273400 6:108561601-108561623 ACCGCTGCCACCGCCGCAGCCGG + Exonic
1013803315 6:113970913-113970935 TCCCCGGCCACCGCCGCCACCGG + Exonic
1014137540 6:117907190-117907212 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1015149219 6:130019840-130019862 CCCGCGGCGGCCGTCCGCGCGGG + Intronic
1015773470 6:136792004-136792026 CCAGCTGCCACCGCCGCCGCCGG - Exonic
1015910107 6:138161628-138161650 CCCGCGGCCACCGTCGGCTCAGG + Intergenic
1015994940 6:138987944-138987966 CCCGCGGCCGGAGCCGGAGCCGG - Exonic
1017672281 6:156778840-156778862 GCCGCCGCCGCCGCCCGCGCCGG - Exonic
1018400494 6:163415143-163415165 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1019298497 7:291161-291183 CGCGCCGCCGCCGCCGCCGCCGG - Intergenic
1019437185 7:1028278-1028300 CCCGCGGGCACGGACGGCGCCGG + Intronic
1019474247 7:1236432-1236454 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1019577680 7:1745421-1745443 CCCGCCGCCCCCGCCTCCGCCGG + Exonic
1022739726 7:33109417-33109439 GCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1022943778 7:35262236-35262258 CCTGAGGCCACCGCCGGTCCCGG + Intergenic
1023618480 7:42045419-42045441 TCAGCTGCCACCGCCGGCACGGG - Exonic
1026360873 7:69599748-69599770 CCCGCCGCCGCCGGCCGCGCCGG - Exonic
1027228586 7:76260013-76260035 ACCGCGGCCACCGCGGGTACAGG + Exonic
1029640538 7:101816756-101816778 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1029708207 7:102286496-102286518 CCCGGGGCCACCACCACCGCGGG + Intronic
1029849391 7:103446268-103446290 CCCGCCGCCACCCTCCGCGCTGG + Intergenic
1031043570 7:116862981-116863003 CGCGGGGCCTCCGCCGGGGCCGG + Intronic
1031886600 7:127251698-127251720 CCCGCGCCCACGCCCCGCGCGGG + Intronic
1031966578 7:128031733-128031755 GCTGCGGCCGCCGCCGCCGCCGG - Intronic
1032306121 7:130733804-130733826 CCCGCCCCCAGCCCCGGCGCGGG - Exonic
1032344314 7:131105797-131105819 CGCGCGCCCTCCGCGGGCGCAGG + Intergenic
1033390646 7:140924609-140924631 CCCGAGGCCGGCGCCGGCGCCGG - Exonic
1034147255 7:148884210-148884232 CGCGCCGCCGCCGCCGCCGCCGG + Exonic
1034441076 7:151086400-151086422 ACCGCCGCCCCCGCCGGCTCCGG - Intronic
1034545474 7:151786050-151786072 CCAGCGCCCACCCCCAGCGCTGG - Intronic
1035127062 7:156616488-156616510 CCCGCGGCCAGCGCCAACGCAGG - Intergenic
1035169541 7:157009947-157009969 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1035171470 7:157019588-157019610 CCATCGGCCGCCGCCGGCGGAGG + Intergenic
1035265983 7:157690563-157690585 CCGGCGCCCAGCGCCCGCGCGGG + Intronic
1036755155 8:11466668-11466690 CCCGCCGCCTCCTCCTGCGCGGG + Exonic
1036811174 8:11868281-11868303 TCCGGGGCCACCGCCGGGGGCGG + Intronic
1038041445 8:23727125-23727147 CCCGGGGCCGCCGCCCGCCCCGG - Intergenic
1038266799 8:26044353-26044375 CGCGCCGCCACTGCCAGCGCCGG + Intronic
1038554122 8:28494565-28494587 CCAGCCGCCACCGCGGGCCCGGG - Intronic
1039212813 8:35235794-35235816 GCGGCGGCCACCGCAGGCGGCGG + Exonic
1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG + Exonic
1039949045 8:42153404-42153426 CCCGCGGCCTCCGTCGCCGCCGG + Intronic
1041059500 8:54022274-54022296 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1041648796 8:60281188-60281210 CCCGCGCCCAGCGAAGGCGCAGG - Exonic
1042155691 8:65841973-65841995 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1042532864 8:69833000-69833022 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1044862162 8:96534071-96534093 CCAGTGGGCACCGCCGGCCCCGG - Intronic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1045738014 8:105318843-105318865 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1049145970 8:141001239-141001261 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1049419467 8:142510555-142510577 CCCGCGCCCCCGGCCCGCGCGGG - Intronic
1049613710 8:143567420-143567442 GCCGCGGCCACAGCCGGCTTGGG + Exonic
1049659964 8:143815508-143815530 GACGCGGCCGCGGCCGGCGCTGG + Intergenic
1049721079 8:144115869-144115891 CACGCAGGCCCCGCCGGCGCAGG - Intronic
1049762214 8:144336717-144336739 ACCGCGGCCAGCGCCGGCCTGGG + Intergenic
1049804004 8:144530760-144530782 ACCACGGCCACCGCCGCCTCGGG + Exonic
1049936317 9:504605-504627 CGCACGGCCGCCGCCGGGGCGGG - Intronic
1051170173 9:14313779-14313801 GCCGAGGCCGCCGCCGCCGCCGG + Intronic
1052192790 9:25678178-25678200 CACGCCGCCGCCGCCGCCGCTGG + Exonic
1052362157 9:27573213-27573235 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053114608 9:35490118-35490140 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1054835570 9:69672286-69672308 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1057489145 9:95508368-95508390 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1059633937 9:116154346-116154368 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1060514582 9:124257940-124257962 GCCGCCGCCACCGCCTGCGCGGG - Intronic
1060554931 9:124503397-124503419 CCCGCGGCGTCCGCCTGCGGAGG + Exonic
1061084947 9:128393190-128393212 ACCGCCGCCACCGCCACCGCAGG - Intergenic
1061141843 9:128771987-128772009 CCCGCGGCTAACGCGGGCGGCGG + Intronic
1061241734 9:129378497-129378519 CCCGCGGCCACCCCCACCCCTGG - Intergenic
1062022595 9:134326513-134326535 GCCGCCGCCACCGCAGCCGCCGG + Intronic
1062629969 9:137459143-137459165 CCCGCGCCCGCCGCCTCCGCCGG + Exonic
1186349977 X:8731366-8731388 CCCGCGGGCACCTGCGGGGCTGG + Intronic
1187226039 X:17375967-17375989 GCCGCCGCCACTGCCCGCGCCGG + Exonic
1187518154 X:19990952-19990974 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1189137119 X:38561513-38561535 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1190745603 X:53320458-53320480 GCTGTGGCCTCCGCCGGCGCCGG + Exonic
1190745619 X:53320517-53320539 GCCGCGGCCACCGCGGGAGCGGG - Exonic
1194977594 X:100409721-100409743 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1198276332 X:135098371-135098393 TCCGCGGCCGCCGCCGCCGCCGG + Intergenic
1198807171 X:140504066-140504088 GCCGCGGCCGCCGCCGCCTCGGG - Exonic
1199500389 X:148500732-148500754 CCCGCCGCCGCTGCCGCCGCCGG + Exonic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic