ID: 1039514309

View in Genome Browser
Species Human (GRCh38)
Location 8:38119311-38119333
Sequence AAGCGCAAACAGCAGGATGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039514309 Original CRISPR AAGCGCAAACAGCAGGATGG AGG Exonic
900753682 1:4418055-4418077 AACTGCATACAGCAGAATGGTGG - Intergenic
901796758 1:11684018-11684040 AATCACAAACAGAAGGAAGGTGG + Intronic
903389568 1:22954240-22954262 AGGGTCATACAGCAGGATGGAGG + Intronic
903815677 1:26062691-26062713 AAGCACAAATAACAGGTTGGAGG - Intronic
904534533 1:31190469-31190491 AAGGTCACACAGCAGGTTGGTGG + Intronic
904897142 1:33825559-33825581 AAGCGCAGAGCCCAGGATGGAGG + Intronic
905392615 1:37647374-37647396 AAAAGCAAACAACAGGTTGGAGG - Intergenic
907286801 1:53385695-53385717 AAGGGCACACAGCAAGTTGGTGG - Intergenic
907630955 1:56081321-56081343 AAGCCCAAACAGCAGAAGGCCGG + Intergenic
908791427 1:67786540-67786562 ACTCACAAGCAGCAGGATGGTGG - Intronic
910267342 1:85351768-85351790 AAGGGCAGAAAGCAGGATGGTGG + Intronic
913435048 1:118838377-118838399 AAGCACACACAGCAGGACTGGGG + Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915520607 1:156440181-156440203 GAGCAGAGACAGCAGGATGGTGG - Intergenic
918047990 1:180952874-180952896 AAGGTCAAACAGGAGGCTGGAGG - Intergenic
918735692 1:188060135-188060157 TAGCCCAAACAGCAGGATATTGG - Intergenic
919107896 1:193176887-193176909 AAATGCAAACAGCAGGCAGGTGG - Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
921203925 1:212831943-212831965 AACAGAAAACAGCAGGGTGGGGG - Intronic
922060241 1:222082342-222082364 AAGCTCAAAGAGCAGGGTGAGGG - Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
1063460495 10:6212352-6212374 AAGACAAAACAGCAGGAAGGGGG - Intronic
1063899752 10:10720086-10720108 AAGGGCAGACAGTGGGATGGTGG + Intergenic
1067014171 10:42743861-42743883 AACCGGATACAGCAGAATGGCGG - Intergenic
1067038824 10:42937747-42937769 AAGCGCAAACACAAGGTGGGAGG + Intergenic
1078852664 11:15178706-15178728 AAGGTCACACAGCAAGATGGTGG + Intronic
1078920672 11:15827234-15827256 AAGTGTAAACAGGAGGTTGGGGG - Intergenic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085692627 11:78676183-78676205 CAGCGCAAAGAGCAGGCTCGGGG - Exonic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1090806083 11:130203179-130203201 CAGGGCAAAGAGCTGGATGGGGG + Intronic
1091789300 12:3262547-3262569 AAGGGCAAACGGCAGGGTGGAGG - Intronic
1091907245 12:4198876-4198898 AAGGGCAAGTTGCAGGATGGAGG - Intergenic
1094443829 12:30508091-30508113 AAGAACAAAGAGGAGGATGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1100429160 12:94515208-94515230 AACCCAAAACAACAGGATGGGGG + Intergenic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1103176474 12:118867905-118867927 AAGGGCACACAGCTGGTTGGTGG - Intergenic
1103352239 12:120292245-120292267 GTGCGGAAACAGCAGGGTGGGGG + Intergenic
1103958883 12:124595080-124595102 AAGCGCACAGAGTAGGATGGAGG + Intergenic
1106915817 13:34513051-34513073 AAGTGCAAACAACAGAATGTTGG - Intergenic
1108267803 13:48730007-48730029 GTGTGCAAACAGCAGGGTGGTGG - Intergenic
1110068128 13:71134905-71134927 ATGCACAAAAAGCAGGAAGGAGG + Intergenic
1111535845 13:89601563-89601585 AATATCAAAGAGCAGGATGGGGG + Intergenic
1112979442 13:105363887-105363909 AAGCGCCATCAGCAGGAAGCAGG - Intergenic
1117718399 14:58604063-58604085 AAGAGGAAACACCAGGATGGGGG - Intergenic
1118977368 14:70689195-70689217 AAGAACAAAGAGCAAGATGGGGG + Intergenic
1119851891 14:77872251-77872273 AGGGTCACACAGCAGGATGGTGG + Intronic
1121085102 14:91139892-91139914 AAGGGGAGAAAGCAGGATGGAGG + Intronic
1123798490 15:23797765-23797787 AAGCGGGAAAGGCAGGATGGAGG + Intergenic
1124158639 15:27250044-27250066 AAGAACAGACAGGAGGATGGAGG - Intronic
1126259548 15:46672248-46672270 AAGCCCAAATAGCATGATAGCGG - Intergenic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1129085380 15:73084331-73084353 AAATGCAGACAGCAGAATGGTGG - Intronic
1129305193 15:74655694-74655716 AACAGCAACCAGCAGGATGTGGG + Intronic
1130408507 15:83624421-83624443 AAGCGCAAAGAGCAGGAAGCGGG + Intergenic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1134395028 16:13854705-13854727 AAACACAAAAAGCAGGATGAGGG - Intergenic
1134396098 16:13864974-13864996 ATGCCCCAACAGCAGCATGGCGG + Intergenic
1135164821 16:20129753-20129775 AAGCAGACATAGCAGGATGGTGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1138795672 16:59965631-59965653 AACCGGAAACAGCAGTAGGGTGG - Intergenic
1141332730 16:83126943-83126965 AAGAGCAAATGGCAGGATGAAGG + Intronic
1141582224 16:85007607-85007629 AAGCGTTAACATCAGGAAGGAGG + Intronic
1144414524 17:15033705-15033727 AAGGGCTAACAGCTGGATGCTGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1146066626 17:29640779-29640801 AAGCACAAAATTCAGGATGGAGG - Intronic
1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG + Intergenic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1152352717 17:79792401-79792423 ACGGACAAACAGCAGGACGGAGG + Exonic
1152978454 18:248385-248407 AAGGGCAAACACCAAGATGATGG + Intronic
1155100826 18:22608153-22608175 AAACACAAACAGCTGGCTGGAGG + Intergenic
1155763032 18:29589653-29589675 AAGGGCACAGAGCTGGATGGAGG + Intergenic
1156574326 18:38297037-38297059 AAGAGCAAACAGCTGGTGGGTGG - Intergenic
1157454225 18:47811707-47811729 AAAGGCAAAGAGCAGGGTGGAGG + Exonic
1158637066 18:59168783-59168805 CAGCTCAAACAGGAAGATGGCGG + Intergenic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161586352 19:5107879-5107901 AGAAGCAAACAGCAGGAAGGAGG - Intronic
1161686128 19:5703517-5703539 AAGAGCACACGGCAGGATTGGGG + Intronic
1165808606 19:38596882-38596904 AAGCGCAGACCGCAGGTGGGCGG + Intronic
925736141 2:6965548-6965570 AAGCGCAAACAGCGGGAAGATGG + Intronic
926155222 2:10449609-10449631 AAGAGCACACAGCAAGTTGGGGG - Intergenic
926690757 2:15731720-15731742 AGGCGCAAGTGGCAGGATGGAGG + Intronic
928360768 2:30660534-30660556 ATATGCAAACAGCAGGAAGGTGG + Intergenic
936475274 2:112834087-112834109 AAGGGCACACAGCAGGTTAGAGG + Intronic
937152529 2:119695873-119695895 AAGGCCACACAGCTGGATGGGGG - Intergenic
940483964 2:154274539-154274561 AAGTGCCAAGAGCAGCATGGGGG - Intronic
941957279 2:171217533-171217555 AAAAGCAGACAGCAGGAGGGAGG + Intronic
944428880 2:199612026-199612048 AAGAGGAAATAACAGGATGGGGG - Intergenic
944534218 2:200693878-200693900 AAGAACAAACTCCAGGATGGGGG + Intergenic
945935350 2:215898114-215898136 AAGTGCACACAGCATTATGGGGG - Intergenic
1169357764 20:4922360-4922382 AAGCGGAGACAGCAGGATGAAGG + Intronic
1169980730 20:11380658-11380680 AAGGGCACAGAACAGGATGGAGG + Intergenic
1170447327 20:16441704-16441726 AAGTGCACCCAGCAGGATAGAGG - Intronic
1170622234 20:18005793-18005815 AATGACAAATAGCAGGATGGTGG - Intronic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1172661068 20:36569235-36569257 AATTGCAAACAGCTGGTTGGTGG + Intergenic
1173112740 20:40208719-40208741 TAACGAAAACAGCATGATGGTGG + Intergenic
1173667111 20:44771032-44771054 AAGGTCACACAGCAGGAAGGGGG + Intronic
1174737328 20:52977179-52977201 AATCTCAACCAACAGGATGGAGG + Intronic
1175203711 20:57294991-57295013 AAGAGCAAAGAGCAGATTGGGGG + Intergenic
1177099294 21:16879936-16879958 AAGGGCACAGAGCTGGATGGAGG + Intergenic
1178021700 21:28415808-28415830 AAGCGCAAACAGAAGATAGGTGG - Intergenic
1179261599 21:39762946-39762968 TAGAGCAAACAGCCAGATGGGGG - Intronic
1180730026 22:17974210-17974232 CAGGGCAGACAGCAGGGTGGTGG - Intronic
1181947911 22:26532625-26532647 AAGGGCATACAGCCAGATGGTGG + Intronic
1183166153 22:36148742-36148764 AAGTGGAAACAGCAGGGTCGGGG - Intronic
1183339368 22:37271121-37271143 GAGGGCACACAGCAGGCTGGCGG + Intergenic
1184404188 22:44290885-44290907 AAGGTCACACAGCAGGATTGAGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
950125099 3:10505819-10505841 AACCGCAAACAACAGCGTGGTGG - Intronic
952196056 3:31076258-31076280 GAGCGTGAAAAGCAGGATGGTGG + Intergenic
953852218 3:46473037-46473059 AGGCGCAAGAGGCAGGATGGAGG - Intronic
958609491 3:96406344-96406366 AAGCGGGAAAAGCAGGAGGGAGG + Intergenic
960092615 3:113656859-113656881 ATGCACCAACAGCAGGATGTTGG - Exonic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964873220 3:161336205-161336227 AAGCTCAGACAGGTGGATGGTGG + Intergenic
965820378 3:172679010-172679032 AAGCGGACACAGCAGTAGGGTGG - Intronic
971100425 4:23460178-23460200 AAAGGCAGACAGTAGGATGGTGG - Intergenic
982257674 4:153466382-153466404 GAGCGCGAGCAGCAGCATGGCGG + Exonic
984117597 4:175701688-175701710 ACCCGCATAGAGCAGGATGGTGG + Exonic
985607495 5:865927-865949 AAGGCCAGACAGCTGGATGGAGG + Intronic
985912392 5:2894689-2894711 CAGCGCAAGCTACAGGATGGAGG - Intergenic
985913378 5:2899661-2899683 TAGGGCAAACATCAGGGTGGAGG - Intergenic
986400350 5:7372881-7372903 AAGACCAATCAGCAAGATGGTGG - Intergenic
990487500 5:56273692-56273714 AAGTGCAAAGACCAGGAAGGAGG + Intergenic
993018717 5:82564837-82564859 CAGTGCAATCAACAGGATGGGGG - Intergenic
996287595 5:121813036-121813058 AAGGGCACACAACTGGATGGAGG - Intergenic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
998546490 5:143032306-143032328 AAGCCTCAACTGCAGGATGGTGG + Intronic
1001145355 5:169179016-169179038 AAGAACAAACAGTAGGTTGGTGG + Intronic
1002207720 5:177575197-177575219 AACCGGACACAGCAGGAAGGTGG - Intergenic
1002930112 6:1628091-1628113 AGCTGCAAACAGCAGCATGGAGG + Intronic
1005789972 6:29289712-29289734 ATGGGCAAAGAGCAGGATAGAGG + Intergenic
1006510900 6:34520503-34520525 AAGGTCACACAGCAGGAAGGAGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1013541682 6:111116864-111116886 AATGGCAGACAGAAGGATGGGGG + Intronic
1014159123 6:118147045-118147067 AATCGCAAGGAGCAGGATTGAGG + Intronic
1017174144 6:151486183-151486205 ACACTCAAACAGCAGGATTGAGG + Intergenic
1017971753 6:159317822-159317844 AAGGGGCAAAAGCAGGATGGAGG + Intergenic
1018865221 6:167742007-167742029 AAGGGCAAACTCCAGCATGGTGG - Intergenic
1019265486 7:114961-114983 AAATGCAAATAGCAAGATGGTGG + Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1023713785 7:43022305-43022327 ACAGGCAAACAGAAGGATGGGGG + Intergenic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1026288194 7:68982340-68982362 AAGCGGACACAGCAGTAAGGTGG + Intergenic
1029380493 7:100211240-100211262 AAACAGAAACAGCAAGATGGAGG - Intronic
1029877309 7:103767899-103767921 AAGAGCATACAGCTGGATGGAGG - Intronic
1030580148 7:111344811-111344833 AAGGACAAACAGGAGAATGGAGG + Intronic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1037340949 8:17844293-17844315 AAGCCCAAACACCAGGAAGGTGG - Intergenic
1037638470 8:20721524-20721546 AAAAGCAGAAAGCAGGATGGAGG - Intergenic
1037889049 8:22613036-22613058 AAACGCAAACAGCGGGCTGGTGG + Exonic
1038046420 8:23769014-23769036 AAGGGCAAAAAGCAGGCTGCAGG + Intergenic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038569815 8:28651262-28651284 TAGTGCAAACAGCAGCATGGTGG - Intronic
1038854674 8:31318416-31318438 AAGCTGAGACAGCAGGATGGAGG + Intergenic
1039514309 8:38119311-38119333 AAGCGCAAACAGCAGGATGGAGG + Exonic
1045866978 8:106878529-106878551 AAGCACAAAGAGAAGGTTGGAGG - Intergenic
1046779515 8:118200365-118200387 AAGCCCAATCAGCACGATGAAGG + Intronic
1046946089 8:119975673-119975695 AAGCCAAGACAGCAGGATGAGGG + Intronic
1047665968 8:127091432-127091454 AAGTGGACACAGCAGGAAGGTGG + Intergenic
1049444066 8:142622016-142622038 AAGCGCAGCCATCAGGGTGGGGG - Intergenic
1055389334 9:75801979-75802001 AAGCTCAGACAGGAGGCTGGTGG - Intergenic
1056457998 9:86781880-86781902 TAGGGCAAGCAGCAAGATGGAGG - Intergenic
1057298512 9:93862937-93862959 ATGGGCAATCAGCAGGATGTGGG - Intergenic
1060006583 9:120005639-120005661 AAGGGCAATCAGCAAGTTGGGGG - Intergenic
1060378613 9:123142585-123142607 AAGAGGAAACATCAGGATGAAGG - Intronic
1060667579 9:125441523-125441545 AAGCGCAAAAAGCTCGATGGAGG + Intronic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1061546684 9:131308578-131308600 AACAGCAAAAATCAGGATGGTGG + Exonic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1061848573 9:133401786-133401808 AAGAGCACTCAGCAGGGTGGAGG - Exonic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1187041916 X:15605452-15605474 GTGCTGAAACAGCAGGATGGAGG + Intergenic
1189239501 X:39514792-39514814 CAGCACAAACAGCAGGGAGGGGG - Intergenic
1192219983 X:69191295-69191317 AAGGTCAAACAGCAGGAAAGTGG - Intergenic
1197549391 X:127870261-127870283 AAGAGCAGACAGCAGAATGGTGG + Intergenic
1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG + Intergenic
1200108683 X:153727960-153727982 AAGCCCATACAGCCTGATGGTGG - Intronic