ID: 1039515665

View in Genome Browser
Species Human (GRCh38)
Location 8:38131211-38131233
Sequence AAGAGTTCCGGGAGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039515665_1039515673 21 Left 1039515665 8:38131211-38131233 CCATCCTGCCTCCCGGAACTCTT No data
Right 1039515673 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data
1039515665_1039515670 3 Left 1039515665 8:38131211-38131233 CCATCCTGCCTCCCGGAACTCTT No data
Right 1039515670 8:38131237-38131259 ATGTATACCACACTGATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039515665 Original CRISPR AAGAGTTCCGGGAGGCAGGA TGG (reversed) Intronic