ID: 1039515668

View in Genome Browser
Species Human (GRCh38)
Location 8:38131222-38131244
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039515668_1039515670 -8 Left 1039515668 8:38131222-38131244 CCCGGAACTCTTTAAATGTATAC No data
Right 1039515670 8:38131237-38131259 ATGTATACCACACTGATGCCTGG No data
1039515668_1039515674 25 Left 1039515668 8:38131222-38131244 CCCGGAACTCTTTAAATGTATAC No data
Right 1039515674 8:38131270-38131292 CACAGAGGTCTGCACTTAAAAGG No data
1039515668_1039515673 10 Left 1039515668 8:38131222-38131244 CCCGGAACTCTTTAAATGTATAC No data
Right 1039515673 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039515668 Original CRISPR GTATACATTTAAAGAGTTCC GGG (reversed) Intronic