ID: 1039515669

View in Genome Browser
Species Human (GRCh38)
Location 8:38131223-38131245
Sequence GGTATACATTTAAAGAGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039515669_1039515673 9 Left 1039515669 8:38131223-38131245 CCGGAACTCTTTAAATGTATACC No data
Right 1039515673 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data
1039515669_1039515670 -9 Left 1039515669 8:38131223-38131245 CCGGAACTCTTTAAATGTATACC No data
Right 1039515670 8:38131237-38131259 ATGTATACCACACTGATGCCTGG No data
1039515669_1039515674 24 Left 1039515669 8:38131223-38131245 CCGGAACTCTTTAAATGTATACC No data
Right 1039515674 8:38131270-38131292 CACAGAGGTCTGCACTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039515669 Original CRISPR GGTATACATTTAAAGAGTTC CGG (reversed) Intronic