ID: 1039515673

View in Genome Browser
Species Human (GRCh38)
Location 8:38131255-38131277
Sequence CCTGGTTTTACAGAACACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039515665_1039515673 21 Left 1039515665 8:38131211-38131233 CCATCCTGCCTCCCGGAACTCTT No data
Right 1039515673 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data
1039515666_1039515673 17 Left 1039515666 8:38131215-38131237 CCTGCCTCCCGGAACTCTTTAAA No data
Right 1039515673 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data
1039515667_1039515673 13 Left 1039515667 8:38131219-38131241 CCTCCCGGAACTCTTTAAATGTA No data
Right 1039515673 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data
1039515668_1039515673 10 Left 1039515668 8:38131222-38131244 CCCGGAACTCTTTAAATGTATAC No data
Right 1039515673 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data
1039515669_1039515673 9 Left 1039515669 8:38131223-38131245 CCGGAACTCTTTAAATGTATACC No data
Right 1039515673 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039515673 Original CRISPR CCTGGTTTTACAGAACACAG AGG Intronic