ID: 1039515674

View in Genome Browser
Species Human (GRCh38)
Location 8:38131270-38131292
Sequence CACAGAGGTCTGCACTTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039515671_1039515674 3 Left 1039515671 8:38131244-38131266 CCACACTGATGCCTGGTTTTACA No data
Right 1039515674 8:38131270-38131292 CACAGAGGTCTGCACTTAAAAGG No data
1039515672_1039515674 -8 Left 1039515672 8:38131255-38131277 CCTGGTTTTACAGAACACAGAGG No data
Right 1039515674 8:38131270-38131292 CACAGAGGTCTGCACTTAAAAGG No data
1039515669_1039515674 24 Left 1039515669 8:38131223-38131245 CCGGAACTCTTTAAATGTATACC No data
Right 1039515674 8:38131270-38131292 CACAGAGGTCTGCACTTAAAAGG No data
1039515668_1039515674 25 Left 1039515668 8:38131222-38131244 CCCGGAACTCTTTAAATGTATAC No data
Right 1039515674 8:38131270-38131292 CACAGAGGTCTGCACTTAAAAGG No data
1039515667_1039515674 28 Left 1039515667 8:38131219-38131241 CCTCCCGGAACTCTTTAAATGTA No data
Right 1039515674 8:38131270-38131292 CACAGAGGTCTGCACTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039515674 Original CRISPR CACAGAGGTCTGCACTTAAA AGG Intronic