ID: 1039517450

View in Genome Browser
Species Human (GRCh38)
Location 8:38145731-38145753
Sequence TTAAGGTTCTTAAACTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 397}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039517444_1039517450 1 Left 1039517444 8:38145707-38145729 CCTGCCCCATGCTTCAGAAAATT 0: 1
1: 0
2: 0
3: 12
4: 212
Right 1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 397
1039517443_1039517450 2 Left 1039517443 8:38145706-38145728 CCCTGCCCCATGCTTCAGAAAAT 0: 1
1: 0
2: 1
3: 19
4: 242
Right 1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 397
1039517442_1039517450 8 Left 1039517442 8:38145700-38145722 CCTCAGCCCTGCCCCATGCTTCA 0: 1
1: 0
2: 5
3: 77
4: 577
Right 1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 397
1039517440_1039517450 27 Left 1039517440 8:38145681-38145703 CCTGAGCGTACCAGGTGAACCTC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 397
1039517441_1039517450 17 Left 1039517441 8:38145691-38145713 CCAGGTGAACCTCAGCCCTGCCC 0: 1
1: 0
2: 3
3: 42
4: 507
Right 1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 397
1039517445_1039517450 -3 Left 1039517445 8:38145711-38145733 CCCCATGCTTCAGAAAATTATTA 0: 1
1: 0
2: 2
3: 33
4: 307
Right 1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 397
1039517447_1039517450 -5 Left 1039517447 8:38145713-38145735 CCATGCTTCAGAAAATTATTAAG 0: 1
1: 0
2: 1
3: 27
4: 327
Right 1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 397
1039517446_1039517450 -4 Left 1039517446 8:38145712-38145734 CCCATGCTTCAGAAAATTATTAA 0: 1
1: 0
2: 1
3: 40
4: 372
Right 1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039517450 Original CRISPR TTAAGGTTCTTAAACTTTCT GGG Intronic
902247908 1:15133768-15133790 TTAGGGTTTTTAAACTCTCCAGG - Intergenic
902264674 1:15254169-15254191 TTAAGGTAGTTTTACTTTCTGGG + Intronic
903297464 1:22353433-22353455 TTCAGCTTCTTTAACATTCTGGG + Intergenic
904636636 1:31886736-31886758 TACAGGTTCTTAAACATTCCTGG + Intergenic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
907018216 1:51038375-51038397 TTGAGTTTTTTTAACTTTCTTGG - Intergenic
907505073 1:54912187-54912209 TCAAATTTCTTTAACTTTCTCGG + Intergenic
907988410 1:59555384-59555406 GCAAGGTACTTAAACTCTCTGGG + Intronic
908129481 1:61060346-61060368 TTAATTTTTATAAACTTTCTTGG + Intronic
908178555 1:61580620-61580642 TTAGGTTGCTTAACCTTTCTTGG - Intergenic
909104448 1:71391485-71391507 TTAAGGTTCTACAAATCTCTAGG - Intergenic
909117787 1:71561184-71561206 ATAAGCTTCTCAAACTTCCTTGG - Intronic
910936662 1:92488598-92488620 GCAAGGTTCTTAACCTCTCTGGG - Intergenic
911305765 1:96230258-96230280 TTAAGGTTCATAATATTTCCAGG + Intergenic
911684142 1:100755021-100755043 TTAATGTTTTTAACATTTCTGGG - Intergenic
911865199 1:103009557-103009579 TTAATGTTCTGAAAGTTTTTGGG - Intronic
911878338 1:103198784-103198806 AAAAAGTTCTTAAAATTTCTTGG - Intergenic
912029167 1:105217686-105217708 CTATGGTTCTTAACCTTTCTTGG + Intergenic
915620089 1:157076411-157076433 TTAGGATTCTTATACTGTCTGGG + Intergenic
917610898 1:176688068-176688090 TTTAGATACTTAAACTTTATAGG + Intronic
918419409 1:184348785-184348807 GTAAGGTTCTTAAAATATATGGG - Intergenic
919013922 1:192004029-192004051 TTGGGGTTCTTAAACATTTTGGG + Intergenic
919111060 1:193219025-193219047 TTAAGGTCCTTATACATTCTGGG - Intronic
919185660 1:194145184-194145206 TCAAGGTCCTTAAACTTTAGGGG + Intergenic
919398390 1:197079501-197079523 TTAATGTTTTTAACGTTTCTAGG + Intergenic
919507247 1:198414732-198414754 TTAAGGTTCTTCAAATTTCAAGG + Intergenic
920121098 1:203659052-203659074 CTAAGGTCCTTATATTTTCTAGG + Intronic
920703589 1:208235822-208235844 TTCAAGTTCTTCAGCTTTCTTGG - Intronic
921767313 1:218987524-218987546 TTAAGCTCCTTATACATTCTGGG + Intergenic
1063750918 10:8946201-8946223 TTTAGGTTTTTAGACTTTCATGG - Intergenic
1065019293 10:21490111-21490133 TTAAGAATTTTAAAATTTCTGGG - Intergenic
1065038679 10:21667345-21667367 TTGAGGTTCTTAAACTGTGGGGG + Intronic
1065110053 10:22431717-22431739 TCAAGTTTCTTAAGTTTTCTAGG + Intronic
1065159165 10:22901195-22901217 TTAAGGTTCTTTTATTTTGTGGG + Intergenic
1066094692 10:32060931-32060953 TTAATGTTCTTAATCTGTATAGG - Intergenic
1066434080 10:35380708-35380730 GCAAGGTTCTTAATCTCTCTGGG - Intronic
1068242413 10:54320214-54320236 TTCATTTTCATAAACTTTCTTGG - Intronic
1068303372 10:55175063-55175085 ATAAGGTTCTTCCCCTTTCTTGG - Intronic
1068723948 10:60279882-60279904 TTAAGGTGCCTATACTTTATAGG - Intronic
1068918070 10:62454543-62454565 TAGAGGTTCTCAAGCTTTCTTGG - Intronic
1069011629 10:63380404-63380426 TGAAGATTTTTCAACTTTCTTGG - Exonic
1069088732 10:64173726-64173748 TGAAGGTTCTTGAACTTTTTTGG + Intergenic
1069161413 10:65097801-65097823 TTAAGGTTTTTAAAATATGTTGG - Intergenic
1070085962 10:73237314-73237336 TAGAAGTTCTCAAACTTTCTGGG - Intronic
1071014547 10:80979775-80979797 TTCAGGTTCTTAGAATTTTTTGG + Intergenic
1072038827 10:91588863-91588885 CTAGGTTTCTTAAGCTTTCTGGG + Intergenic
1072138445 10:92569524-92569546 TAAAGATTCCTAAAGTTTCTTGG - Intronic
1072324055 10:94279221-94279243 TCAAGTTTCCTAAAGTTTCTAGG + Intronic
1072345534 10:94501502-94501524 TTAAGTTTCTTAAACTTTGGTGG + Intronic
1072427018 10:95338177-95338199 TCAAGGTTCTGACATTTTCTTGG + Intronic
1072773997 10:98170845-98170867 TTATCTTTCTAAAACTTTCTGGG + Intronic
1072978150 10:100076961-100076983 TTGAGGATCTGAAAGTTTCTGGG + Intronic
1074294971 10:112177507-112177529 TTAGAGTTCTTACAATTTCTAGG - Intronic
1074378515 10:112959059-112959081 TTAAAGCTCTTAAACTGTCTGGG - Intronic
1074700528 10:116088191-116088213 ACAAGTTTCTGAAACTTTCTAGG + Intronic
1075970831 10:126650789-126650811 TTAGGTTTCTTATCCTTTCTGGG - Intronic
1077432235 11:2521664-2521686 TTAAGGTTCCTCAACTTTATTGG + Intronic
1078353000 11:10610434-10610456 TTAAACTTCTAAAACTATCTTGG + Intronic
1080563061 11:33482225-33482247 TTAATTTTCTTGAATTTTCTAGG + Intergenic
1081005286 11:37728657-37728679 GAAAGGTACTTAAATTTTCTGGG - Intergenic
1081478064 11:43456131-43456153 TTAGGGTTCTTAAACTAAGTTGG - Intronic
1083982968 11:66189330-66189352 CTAAGGTACTAAATCTTTCTTGG + Intronic
1084132014 11:67143389-67143411 TTCAGTTTCTGAAAATTTCTTGG + Intronic
1084537137 11:69763928-69763950 ATGAGGTTCTGGAACTTTCTGGG + Intergenic
1085333639 11:75672948-75672970 TTTAGGTTCATAAACTTTTTAGG - Intergenic
1085430884 11:76446422-76446444 TTAAGTTTCTTTAACTTGCTAGG + Intronic
1085608261 11:77922454-77922476 TTCAGGTGCTTGAAGTTTCTGGG - Exonic
1087235291 11:95711389-95711411 TGATTGTTCTAAAACTTTCTTGG - Intergenic
1087477833 11:98659892-98659914 TTTATCTTCTTTAACTTTCTTGG - Intergenic
1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG + Intronic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1087919820 11:103853994-103854016 TTAAGTCACTTAAACTTTCTGGG - Intergenic
1089687037 11:120158698-120158720 TTAAATATCTTAAACTTTGTGGG + Intronic
1089772309 11:120812367-120812389 ACAAGTTACTTAAACTTTCTAGG + Intronic
1089778260 11:120854506-120854528 TTAAGGTTCTTGGACTACCTGGG + Intronic
1091355817 11:134936883-134936905 TTAAGGTTATTAAGCTGTCATGG - Intergenic
1091881588 12:3983283-3983305 TTGAGGTTCTTTAAAGTTCTTGG - Intergenic
1092046994 12:5438603-5438625 TTAAGGTTCTCCAACATTCAAGG + Intronic
1092269758 12:7014151-7014173 TTATGGTGCTTAAAATTTATTGG + Intronic
1092733840 12:11560301-11560323 TTTATGTTCTAAAACCTTCTGGG - Intergenic
1093045135 12:14434782-14434804 TTAAGGTTCTTCATCTTCATGGG + Intronic
1093045196 12:14435167-14435189 ATAAGGTTCTTTAGCTTTATGGG + Intronic
1093098408 12:14998509-14998531 TTTACATTCATAAACTTTCTGGG - Intergenic
1093819216 12:23592162-23592184 GTGAGGTTATTAGACTTTCTTGG + Intronic
1094229732 12:28089272-28089294 TTAAGTTTCTGAATTTTTCTAGG + Intergenic
1095088053 12:38079551-38079573 TGTAGGTTCTTAAAGATTCTGGG + Intergenic
1095312793 12:40720593-40720615 TTATGATTATTAAACTTTCAAGG - Intronic
1097499294 12:60381846-60381868 TTAAGTTTCTTGTACATTCTGGG + Intergenic
1097588671 12:61546046-61546068 GCAAGGTTCTTACTCTTTCTAGG - Intergenic
1098073800 12:66704666-66704688 TTAAGGTTCTTAAGCTCTCTGGG - Intronic
1098860175 12:75700487-75700509 CTAAGATTATTAAATTTTCTGGG + Intergenic
1099212613 12:79811555-79811577 TTAGAGTTCGCAAACTTTCTTGG - Intronic
1101436560 12:104669313-104669335 TGAAGGCTTTTAAACTTGCTGGG + Intronic
1101599886 12:106200074-106200096 TTAAGTTTCTGAACCTCTCTGGG - Intergenic
1101683670 12:106995133-106995155 TTAAGTTACCTAATCTTTCTAGG + Intronic
1101823904 12:108205792-108205814 TTAACTGGCTTAAACTTTCTAGG + Intronic
1104388118 12:128368410-128368432 TTTACCTACTTAAACTTTCTGGG + Intronic
1105269175 13:18854830-18854852 TAAAGGCTCTGACACTTTCTCGG + Intergenic
1105959647 13:25319304-25319326 TGAAGCTTCTTGAATTTTCTAGG + Exonic
1106561552 13:30850922-30850944 TTAAGTTTCTTATAGTTTCTGGG + Intergenic
1107906224 13:45063661-45063683 TTAATGCTCTTAAACCTCCTGGG - Intergenic
1108012333 13:46030520-46030542 TTGAAGTTCTTGAACTTTATAGG - Intronic
1109085640 13:57967788-57967810 GAAAAGTTCTTAAACTATCTTGG - Intergenic
1109173260 13:59122218-59122240 TTAAACTGTTTAAACTTTCTTGG - Intergenic
1109733827 13:66454338-66454360 TCAATGTTCTTAAACATTATAGG - Intronic
1110494963 13:76157498-76157520 GTCAGGTTTTTAAATTTTCTTGG - Intergenic
1110533257 13:76621396-76621418 TTAAATTTCTCAATCTTTCTGGG + Intergenic
1110771736 13:79356464-79356486 TCAAGTTACTTAACCTTTCTGGG + Intronic
1111304874 13:86396311-86396333 TTAAATTTCTTTAATTTTCTTGG - Intergenic
1111849778 13:93558116-93558138 GTAAGTTTCTTAAACTCTCTGGG + Intronic
1112048814 13:95624395-95624417 CAAAGGTTCTTAGCCTTTCTGGG + Intronic
1112994411 13:105555327-105555349 TTCAGGCTCTTGAACTTCCTAGG - Intergenic
1113147702 13:107226853-107226875 GTCAGGGACTTAAACTTTCTGGG - Intronic
1113664770 13:112133804-112133826 TCCAGGGTCTTAAACTTCCTTGG - Intergenic
1114824630 14:26062303-26062325 GTAAGTTTCTTAATCTCTCTGGG - Intergenic
1116160301 14:41259212-41259234 TTCAGGTTTTTATATTTTCTTGG + Intergenic
1116487389 14:45467055-45467077 TAAAGTTTTTTAAACTTCCTGGG - Intergenic
1118567327 14:67156412-67156434 TTAAGGTTCTTGTATTGTCTGGG + Intronic
1118775449 14:68971159-68971181 TCAAGTTTCTTAACCTCTCTGGG + Intronic
1119194959 14:72710809-72710831 TTAAGCTTGGTAAACTTTCAAGG + Intronic
1119247247 14:73122133-73122155 TTAAGTTGCTTGAACTTTGTGGG + Exonic
1119768808 14:77207336-77207358 ATAAGTTTCTTAACCTCTCTGGG + Intronic
1120168386 14:81224211-81224233 TTAAGATTGGTAAACTTGCTTGG - Intergenic
1121027446 14:90626951-90626973 TTAAGTTTCTAGAACTTCCTTGG - Intronic
1121893889 14:97626506-97626528 TGAAGCTTCTTTAACTTTCCAGG + Intergenic
1202830138 14_GL000009v2_random:19168-19190 TAAAGGCTCTGACACTTTCTTGG - Intergenic
1126229407 15:46307560-46307582 TTATGGTTCTTAAACTACATTGG - Intergenic
1127243425 15:57144485-57144507 TTAGAGTTCTTACACTTTATAGG + Intronic
1130382403 15:83381830-83381852 TTAAGGTTTTTAAAATATGTTGG + Intergenic
1133861847 16:9603125-9603147 TTAACTTTCTTAAATTTTCTTGG - Intergenic
1135716482 16:24773820-24773842 TTAATTTTCTTAGCCTTTCTTGG + Intronic
1135941117 16:26822739-26822761 TTAAGGTCATTAAACTTTCTTGG + Intergenic
1142829370 17:2536319-2536341 GTAAGTTTCTTAGTCTTTCTGGG + Intergenic
1143311236 17:5991338-5991360 TTAAGGTCCTTACAGATTCTGGG - Intronic
1146121921 17:30203354-30203376 TTAAGGTTTTTAATGTTTCTTGG - Intronic
1146997790 17:37335912-37335934 TTGAATTTCTTTAACTTTCTCGG - Intronic
1147032984 17:37656250-37656272 CCAAGGTTCCCAAACTTTCTTGG + Intergenic
1147423728 17:40335268-40335290 TTTGGGTTCTTAACCTTTCTTGG + Intronic
1151835220 17:76578347-76578369 TGAAGCTTCTCAAACCTTCTGGG + Intronic
1154418858 18:14205158-14205180 TAAAGGCTCTGACACTTTCTCGG - Intergenic
1155633874 18:27927532-27927554 TTTATGTTCTTAAACTTCTTAGG + Intergenic
1157185335 18:45535712-45535734 TCATGGTTCTTAATCTTTCGGGG + Intronic
1157697577 18:49735265-49735287 TAAAGGTACTGAGACTTTCTGGG - Intergenic
1163181096 19:15602897-15602919 TTAAGTTTCTTATAGATTCTTGG + Intergenic
1164057507 19:21634065-21634087 TCAAATTTCTTTAACTTTCTTGG - Intergenic
1164772813 19:30824788-30824810 TTAAGGTCCTTATATTTTCAAGG - Intergenic
1166178767 19:41092567-41092589 TTAAGACACTTAAACTCTCTGGG - Intronic
1202642551 1_KI270706v1_random:108605-108627 TAAAGGCTCTGACACTTTCTCGG + Intergenic
924996141 2:363754-363776 TTAAGGTTCTGACATTTTCTTGG - Intergenic
926894897 2:17675247-17675269 GTAAGGTTCTTATACTTTTCAGG - Intronic
927051334 2:19332360-19332382 TTAAATTTCTTAAACTATGTTGG + Intergenic
927076052 2:19578714-19578736 GTAAGTTTCATAAACTTTCTTGG + Intergenic
929015714 2:37492529-37492551 TTAAGGTCCTTATAGGTTCTGGG + Intergenic
929205860 2:39291943-39291965 TAAAGTTACATAAACTTTCTAGG - Intronic
929636587 2:43528531-43528553 ATAAGTTTCTTAGCCTTTCTTGG - Intronic
929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG + Intronic
929984135 2:46709573-46709595 TTAATGTTCTATTACTTTCTTGG - Intronic
930346921 2:50194654-50194676 ATAAGTTACTTAAACTCTCTGGG + Intronic
930565147 2:53009315-53009337 TTAAGTGTCATAAACTCTCTTGG - Intergenic
930793796 2:55366130-55366152 GTAAAGTTCTTAAACTATCATGG + Intronic
931485753 2:62689975-62689997 TGAATGTTTTTAAAGTTTCTTGG + Intronic
931488632 2:62720242-62720264 TAGAGGTTCCCAAACTTTCTGGG - Intronic
931572448 2:63682700-63682722 TTGAGGTTCTTAAATCTGCTTGG - Intronic
931752266 2:65340262-65340284 TAACAGTTCTTAAACTTTTTTGG - Intronic
932172517 2:69570199-69570221 TTAAAGTTCTGAAAGTTTGTTGG - Intronic
932177034 2:69612366-69612388 GCAAGTTGCTTAAACTTTCTCGG + Intronic
932345109 2:70990343-70990365 TTCAGGTTCCTCAACATTCTGGG + Intronic
932629850 2:73331176-73331198 TTAAAGTTATTAACATTTCTGGG - Intergenic
932967930 2:76500161-76500183 GTAATGTTCTTTAGCTTTCTGGG + Intergenic
934498393 2:94832059-94832081 TAAAGGCTCTGACACTTTCTCGG + Intergenic
935703495 2:105835635-105835657 TTAAGGATCTTAGAGTTTCCTGG + Intronic
936246651 2:110834315-110834337 TTAAGGGACTTCAGCTTTCTAGG + Intronic
936969237 2:118161010-118161032 ATAAGGTTCTGAAACCTACTGGG - Intergenic
938914234 2:135918733-135918755 ATGAGTTTCTGAAACTTTCTTGG + Intronic
939283189 2:140091470-140091492 TTATGTTTTTTAAACCTTCTTGG + Intergenic
940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG + Intergenic
941094211 2:161217312-161217334 TTAAGGTTCTCAAATTCTCTAGG + Intronic
941317023 2:164006052-164006074 TTGAGGTACTTAAAATCTCTTGG - Intergenic
941321121 2:164055933-164055955 TTAAGCTGCATTAACTTTCTTGG - Intergenic
941655873 2:168144246-168144268 GAAAGGGACTTAAACTTTCTGGG + Intronic
942580107 2:177409003-177409025 CAGAGGTTCTCAAACTTTCTGGG - Intronic
943331890 2:186569796-186569818 TTAGTGTTCTTAAATTTTCCTGG - Intergenic
943332141 2:186572457-186572479 TTAGTGTTCTTAAATTTTCCTGG + Intergenic
943344455 2:186721795-186721817 CAAAGGCTCTAAAACTTTCTTGG + Intronic
943577415 2:189647024-189647046 GGAAGGTTGCTAAACTTTCTGGG - Intergenic
944586211 2:201176054-201176076 TAAAGCTTAATAAACTTTCTTGG - Exonic
945008399 2:205434888-205434910 TTAAGTTTTTAAAATTTTCTTGG + Intronic
946880271 2:224170537-224170559 GCAGGGTTCTTGAACTTTCTTGG + Intergenic
947363799 2:229373214-229373236 TTAAGTTTCTTACAGATTCTGGG - Intronic
947510665 2:230751124-230751146 TTAAGGTTCTTAAGCAGTCATGG - Intronic
1169238058 20:3948585-3948607 TTAAGGTTTTTATACTTCATTGG - Intronic
1169620850 20:7504940-7504962 TTAGGGTTATTAAAGTTTATAGG - Intergenic
1169864023 20:10180787-10180809 TTAAGGTCTTTAAATGTTCTAGG + Intergenic
1170537241 20:17352961-17352983 TTAAGTTTCTTATAGATTCTAGG - Intronic
1170701010 20:18703539-18703561 TCATTTTTCTTAAACTTTCTCGG + Intronic
1171067922 20:22037030-22037052 TTAAGGTTTTTAAAATTTTAAGG - Intergenic
1171889660 20:30698788-30698810 TAAAGGCTCTGACACTTTCTCGG + Intergenic
1172261625 20:33571253-33571275 TTAAGGCTCTTCAACTTTTTTGG + Intronic
1173535851 20:43812750-43812772 TCAAGATTCTTGTACTTTCTTGG - Intergenic
1174673869 20:52334418-52334440 TTAAGCATTTTAAAATTTCTTGG - Intergenic
1174957292 20:55112899-55112921 TTAAGGTTATAAATTTTTCTAGG - Intergenic
1175043659 20:56081079-56081101 TTAAGTTTCTTATAGATTCTGGG - Intergenic
1175513316 20:59550399-59550421 TTAAGTTTCTTACAGATTCTGGG - Intergenic
1176609324 21:8864008-8864030 TAAAGGCTCTGACACTTTCTCGG - Intergenic
1176854450 21:13954118-13954140 TAAAGGCTCTGACACTTTCTTGG + Intergenic
1177252681 21:18614996-18615018 TTAAGATACTTGAGCTTTCTAGG + Intergenic
1177770493 21:25509344-25509366 ATAAGGTTCTTAAACTAACCTGG + Intergenic
1177896580 21:26860830-26860852 TTGAATTTCTTTAACTTTCTTGG - Intergenic
1178279554 21:31269640-31269662 TTAAAGTTCACCAACTTTCTGGG - Intronic
1179007536 21:37528714-37528736 GCAAGGTACTTAAACTATCTGGG + Intergenic
1179037772 21:37774190-37774212 GTAAGTTTCTTAATCTCTCTGGG + Intronic
1179081680 21:38177085-38177107 GTAAGTTTCTTAAACTCTTTAGG + Intronic
1182824709 22:33254811-33254833 TCAAGGTCCTTAAACTATCTTGG + Intronic
1182939071 22:34256290-34256312 TTCATGTACTTAAACTTTATTGG + Intergenic
1183597426 22:38821203-38821225 TTAAGATTCTGACACTCTCTTGG + Exonic
949220661 3:1629921-1629943 TTAATGTTCTGAAACTTCTTTGG + Intergenic
950341698 3:12252476-12252498 TTATTTTTCTTAAAATTTCTCGG + Intergenic
950564520 3:13759632-13759654 TTAAGTTTCTTATAGATTCTGGG - Intergenic
950750211 3:15122557-15122579 TCAAGTTTCTTAACCTCTCTGGG - Intergenic
950987609 3:17391963-17391985 TAAAGGTGCTAGAACTTTCTTGG + Intronic
951492413 3:23286204-23286226 TTTAGTTTCTTATGCTTTCTGGG + Intronic
951693878 3:25426064-25426086 TTAAGGTCCTTAGAGTTCCTTGG - Intronic
951844733 3:27073135-27073157 TTAAGGTGCTTAGTCCTTCTTGG + Intergenic
953415778 3:42715685-42715707 TTCAAGTTCTTAAACTGTATTGG + Intronic
954261949 3:49445645-49445667 TTAAGATCCTTAAACTAGCTGGG - Intergenic
954986182 3:54794898-54794920 TTGAGGTTCATTAACCTTCTTGG + Intronic
955570982 3:60305607-60305629 TTAAGATCTTTAAACTGTCTAGG + Intronic
955711725 3:61786454-61786476 TTATGGTTCTTTATCTTTCAAGG + Intronic
956101527 3:65773220-65773242 TTAAGGTTGTTAATCTTTTGGGG - Intronic
958149595 3:89672511-89672533 TTGATGTTCTTAAATTTACTAGG - Intergenic
958629349 3:96667572-96667594 TTGAATTTCTTTAACTTTCTCGG + Intergenic
959082494 3:101816869-101816891 TGACGCATCTTAAACTTTCTGGG - Exonic
959395121 3:105827540-105827562 TTAAGGTCCTTAAACTCCCATGG + Intronic
959523916 3:107354500-107354522 CGAAGGTTCTTGAACTGTCTTGG - Intergenic
959821855 3:110744651-110744673 TTAAGATCCTCAAACTTTATGGG + Intergenic
960317106 3:116191501-116191523 GAAAGGTTCTTAACCTTCCTGGG - Intronic
960941904 3:122940526-122940548 TTTTGGTTCCTAAACTTTTTAGG + Intronic
962379195 3:134883560-134883582 TTAAATCACTTAAACTTTCTGGG - Intronic
963563645 3:146900079-146900101 TTAAGATTCTGATACTTTATAGG - Intergenic
963990623 3:151649283-151649305 ATAAGGTTCATGAACTATCTTGG + Intergenic
964115259 3:153130172-153130194 TTAAGTTTATTAAAGTGTCTTGG + Intergenic
964122902 3:153205240-153205262 CTAAGTTTCTTAAGCTCTCTAGG + Intergenic
964546890 3:157844268-157844290 TTAAGGTTCATAAACTTCCTTGG + Intergenic
964960781 3:162422562-162422584 TTCAGGTTCTTGTATTTTCTGGG - Intergenic
965339475 3:167469473-167469495 TGAAGCTTCTTAATCTCTCTGGG - Intronic
966729469 3:183138527-183138549 TAAAGGTTATTTAACTTTCCAGG + Intronic
966803880 3:183790581-183790603 TTAAATTTTTTAAATTTTCTTGG + Intronic
969175917 4:5399041-5399063 TCATGGTTCTTAAACTTTGTGGG - Intronic
970376759 4:15466267-15466289 TCAACTTTCTTAACCTTTCTAGG - Intergenic
971174675 4:24270541-24270563 TTCATGTTCATAATCTTTCTGGG - Intergenic
972834157 4:42848608-42848630 TTAAGTTCCTTATACATTCTGGG + Intergenic
972969323 4:44553017-44553039 TTAAGCTTATTAACCTCTCTGGG - Intergenic
973288932 4:48450691-48450713 TTAATATTTTTAAACTTTCAAGG - Intergenic
973333076 4:48929298-48929320 TCAAGATTCTTTCACTTTCTAGG - Intergenic
974808385 4:66913188-66913210 TTAAAGTGCTTTAACTTTCAAGG + Intergenic
975576599 4:75869137-75869159 TAGTGGTTCTTAAACTTTTTAGG - Intronic
975771321 4:77726041-77726063 TTTAGATTCTTAAAATGTCTAGG - Intronic
976116352 4:81732244-81732266 TTAAGTTACTTAAACTCTCTAGG + Intronic
976545744 4:86333731-86333753 CTAAGTTACTTAACCTTTCTGGG + Intronic
977329376 4:95618320-95618342 TTAAGTTCCTTATAGTTTCTGGG - Intergenic
977911766 4:102545487-102545509 TTAAGCTTCTTAATTTCTCTAGG - Intronic
978271063 4:106891790-106891812 TTTAGGTTTCTAAAATTTCTGGG - Intergenic
979032298 4:115665500-115665522 CCAAGGTTCTTACCCTTTCTTGG - Intergenic
979094174 4:116523657-116523679 AAAAGGTTCTCAAACTTTTTAGG - Intergenic
979618411 4:122770493-122770515 TTAAGTTTTATAAACCTTCTTGG + Intergenic
979744954 4:124201188-124201210 TTTGGTTTTTTAAACTTTCTTGG - Intergenic
980141825 4:128926844-128926866 TCAAGGTTCTTGAGTTTTCTGGG + Intronic
980258490 4:130415033-130415055 TTAAGTTTCTTATAGATTCTGGG - Intergenic
980507387 4:133740245-133740267 ATAAATTTCTCAAACTTTCTTGG - Intergenic
980681788 4:136172049-136172071 TTTAGTTTCCTAAACTTTATAGG + Intergenic
981071305 4:140542552-140542574 TTATTTTTCTTAAACTTTTTAGG + Exonic
981353506 4:143760030-143760052 TTAATTTTCATAAACATTCTAGG - Intergenic
982282852 4:153703283-153703305 TTAACATTCTTAAACTTACTGGG + Exonic
983538776 4:168886698-168886720 TTAAGGTACTCATATTTTCTTGG - Intronic
983875781 4:172873099-172873121 CCAAGATTCATAAACTTTCTTGG + Intronic
1202769921 4_GL000008v2_random:194504-194526 TAAAGGCTCTGACACTTTCTCGG + Intergenic
988028649 5:25732933-25732955 TTAAGGTTTTTAACATTTTTAGG - Intergenic
988345522 5:30033246-30033268 TTAATGTTTTTAATCATTCTTGG - Intergenic
989151972 5:38308531-38308553 GCAAGTTACTTAAACTTTCTTGG + Intronic
989296387 5:39831868-39831890 CTAAAATTCTTAAACTTTGTTGG - Intergenic
990856762 5:60276322-60276344 TTAAGATTGCTAAATTTTCTTGG + Intronic
991465535 5:66908510-66908532 TTAATGTTCTTAGAGTTTCGGGG + Intronic
991560776 5:67949547-67949569 TTAAGGTTTTTGAAATTTATTGG + Intergenic
992556735 5:77911209-77911231 TTAATGTTTTTAAATTTTTTGGG - Intergenic
992747174 5:79831202-79831224 TTTAGGTTTTTAATCTTTATTGG - Intergenic
993074413 5:83210485-83210507 GTAACGTACTTAATCTTTCTAGG - Intronic
993323713 5:86507676-86507698 TTAAGCATCTTAAACTTACCAGG + Intergenic
993338264 5:86689152-86689174 TTAAGATTCTTAAGCTTTATGGG + Intergenic
994292092 5:98040102-98040124 TTAAGTTTCTTATAGCTTCTGGG - Intergenic
994964135 5:106644504-106644526 TTAAAGTTTTTAAAAATTCTAGG - Intergenic
995216202 5:109597645-109597667 TTAAGTTTCTAAAACCATCTGGG + Intergenic
995745556 5:115399099-115399121 TTAAGTTTCTTATAGATTCTGGG + Intergenic
996172170 5:120307507-120307529 ATAATGTGCTTAAACTGTCTAGG + Intergenic
996301199 5:121988263-121988285 ATGAGTTTCTTAAAGTTTCTTGG + Intronic
996683128 5:126250150-126250172 TTTAGGATTTTAAATTTTCTGGG - Intergenic
996763111 5:127005683-127005705 TAAAGATTTTTAAACTTTTTGGG - Intronic
997029505 5:130109152-130109174 TTAACGGTTTTAAAGTTTCTTGG - Intronic
997133802 5:131303189-131303211 TCAAGTTTCTTTACCTTTCTGGG + Intronic
997220924 5:132163078-132163100 TTAAGGATGCTAAACTTGCTTGG - Intergenic
997663907 5:135611946-135611968 TCAATGTTCTTAAGTTTTCTTGG - Intergenic
999785607 5:154887467-154887489 CAATGGTTCTTAAACTTTCTTGG - Exonic
1000521277 5:162297755-162297777 TTAAGTTTCTTACAGATTCTGGG + Intergenic
1001498122 5:172204698-172204720 GTAAGGTTCTTAACCTTCCTAGG - Intergenic
1002487468 5:179549484-179549506 TTAAGATTTGTAAACATTCTGGG + Intergenic
1003447645 6:6199557-6199579 GCAAGGTTCTTAACCTTCCTGGG - Intronic
1003751508 6:9063482-9063504 TTAAGGAACTTAAACTTGGTTGG - Intergenic
1004125484 6:12868865-12868887 TTGAGGTTCTTATATTTTCCTGG - Intronic
1004738128 6:18428794-18428816 GTAAGTTACTTAAACCTTCTGGG - Intronic
1005297724 6:24442944-24442966 TAGAGTTTCTCAAACTTTCTTGG - Intronic
1006743828 6:36327409-36327431 ATAAGTTTCTTAACCTCTCTGGG + Intronic
1007190688 6:40015201-40015223 TTAGGGATCTTTTACTTTCTTGG + Intergenic
1008077524 6:47160723-47160745 TTAGGGTTCTTTAACTTAGTAGG - Intergenic
1008823883 6:55667772-55667794 TTAATTTTACTAAACTTTCTAGG + Intergenic
1008870392 6:56265809-56265831 TTAATGTTTTCAAACTATCTAGG - Intronic
1008906680 6:56685261-56685283 TTAAGGTCCTTATAGATTCTGGG - Intronic
1009531012 6:64815557-64815579 TTAAAGTTCTTGATCTTTCCTGG + Intronic
1009535859 6:64884120-64884142 TTAAGAATCATAAACTTTCCTGG + Intronic
1009753719 6:67907071-67907093 TTAAGGTTCTTATCTCTTCTTGG + Intergenic
1009948847 6:70371618-70371640 TGATGGTTCTTAACATTTCTTGG + Intergenic
1010062551 6:71640796-71640818 TAATTGTTCTTAAACTTTGTTGG + Intergenic
1010211931 6:73369103-73369125 TTAACCTTCTCAAAATTTCTTGG - Intronic
1010788754 6:80038135-80038157 TTTAAGTTCTAAAACTTTTTAGG + Intronic
1011369203 6:86614611-86614633 TTAAGTCTCTTAAACGATCTTGG - Intergenic
1011440606 6:87383210-87383232 CAGAGATTCTTAAACTTTCTTGG - Intronic
1011850794 6:91626067-91626089 TTAAGTTTCTTTAATCTTCTTGG + Intergenic
1012466954 6:99526374-99526396 CTAAGGTTCCCAAACTTTCTGGG - Intergenic
1012560415 6:100573413-100573435 TTAGAGTACTTAAACTTTATTGG + Intronic
1012618877 6:101314871-101314893 TTAAGGTGCCTCAACTTTCAAGG - Intergenic
1012711249 6:102609003-102609025 TTAAGTTTCTTATATCTTCTAGG - Intergenic
1012714743 6:102653887-102653909 TTAAGTTTCTTATAGATTCTGGG - Intergenic
1014019390 6:116570656-116570678 TAAAGGTTCTCAACATTTCTCGG + Intergenic
1014041344 6:116830259-116830281 GTATGTTTGTTAAACTTTCTGGG - Intergenic
1014657295 6:124123496-124123518 TTAAGGTTCATAAACTATCTAGG - Intronic
1014726039 6:124972834-124972856 TTAAGGTTATCAAACTATATAGG + Intronic
1014797444 6:125742362-125742384 CTATTGTTCTTAAACTTTATAGG - Intergenic
1014830433 6:126096845-126096867 TTAAGTTCATTCAACTTTCTTGG + Intergenic
1015699419 6:136019196-136019218 TTAAGTTTATTAATCTTGCTTGG - Intronic
1016254375 6:142086919-142086941 GTAGGTTTTTTAAACTTTCTAGG + Intronic
1017002704 6:150006832-150006854 GCAAGGTTCTTCAGCTTTCTGGG + Intergenic
1020533858 7:9369397-9369419 TTAAGTTTCTTAGAGATTCTGGG - Intergenic
1020714971 7:11661896-11661918 TTAAGGTCCTTGCATTTTCTAGG + Intronic
1021203195 7:17749721-17749743 GTAAGATTCTGAAACTGTCTGGG - Intergenic
1024518015 7:50277005-50277027 CTAAGGTTATTAAAAATTCTGGG - Intergenic
1024760630 7:52592876-52592898 CTAGGGGTCTTAAACTTGCTAGG - Intergenic
1025844637 7:65185385-65185407 TTCAGGTGCTTGAAGTTTCTGGG + Intergenic
1025894966 7:65691723-65691745 TTCAGGTGCTTGAAGTTTCTGGG + Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026136032 7:67661639-67661661 TTCAGCTTATAAAACTTTCTTGG - Intergenic
1026273393 7:68855772-68855794 TTAACGTTTTTAAGATTTCTTGG + Intergenic
1026302925 7:69114302-69114324 TTAAGGTTCATTAAGCTTCTTGG + Intergenic
1027723052 7:81769311-81769333 TTAAAGATCTTATTCTTTCTGGG - Intronic
1028564534 7:92214535-92214557 ATAACATTTTTAAACTTTCTTGG + Intronic
1029362508 7:100097757-100097779 TTAAGGTTGTTTTATTTTCTGGG + Intronic
1030474408 7:110011509-110011531 TCAAAGTGCTGAAACTTTCTTGG + Intergenic
1030908833 7:115221106-115221128 TCAAGTTTTTTAAACTTTCCAGG - Intergenic
1030922088 7:115403757-115403779 TTAAGTTTCTTATAGATTCTGGG - Intergenic
1031174123 7:118327889-118327911 TAAAGCTTCTTAGATTTTCTTGG - Intergenic
1031890585 7:127289172-127289194 TTAAAGATTTTAAACTTGCTGGG - Intergenic
1032179719 7:129664196-129664218 TTAAGGTTTTAAAATTTTCTGGG + Intronic
1032842973 7:135728425-135728447 TTCAGTTTCTCAAACTTCCTAGG + Intronic
1033268722 7:139911716-139911738 TTAATACTCTTATACTTTCTGGG - Intronic
1034121281 7:148630178-148630200 TTAAGGGTTTTATACTTTCACGG + Intergenic
1034214012 7:149389617-149389639 TTAAGGTTCTTGCAGTTTCATGG + Intergenic
1034777020 7:153837419-153837441 TTAAGGTATTTAAGCTGTCTGGG - Intergenic
1035071365 7:156147574-156147596 TGAAGGCTCTTAAAGTTCCTTGG - Intergenic
1036435374 8:8728484-8728506 TTAAGTTTCTTAGACCCTCTGGG + Intergenic
1036455955 8:8907754-8907776 TAAAAGTTATTAAATTTTCTTGG - Intergenic
1037150615 8:15631042-15631064 TTAAGTTTCCTTAAATTTCTTGG + Intronic
1037160222 8:15760743-15760765 TTAAGTATTTTAAACTTTGTGGG - Intronic
1037267360 8:17079398-17079420 TAATGATTCTAAAACTTTCTGGG - Intronic
1037350365 8:17947729-17947751 TTAAGGTTTTAACCCTTTCTTGG - Intronic
1037523372 8:19701742-19701764 GTAAATTACTTAAACTTTCTGGG - Intronic
1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG + Intronic
1039584505 8:38694928-38694950 TGAAGCTTCTTTTACTTTCTGGG + Intergenic
1039584730 8:38696786-38696808 ACAAGTTCCTTAAACTTTCTAGG - Intergenic
1041456094 8:58061912-58061934 TTAAGGTTCTTTCTCTTTCTTGG - Intronic
1042360319 8:67875617-67875639 TTAAGTTTCTTATAGATTCTGGG - Intergenic
1042628351 8:70786076-70786098 TTAATTTTCTGAAATTTTCTTGG + Intronic
1043552884 8:81394723-81394745 TGATGGTTCTTAACATTTCTTGG - Intergenic
1043619169 8:82166510-82166532 TTGAGGTTCTTTAAAGTTCTTGG + Intergenic
1043802436 8:84627133-84627155 ATATGGTTCTTAACCTTTCAGGG + Intronic
1044481488 8:92694929-92694951 TACAGGTTCTTAATCTTTTTTGG + Intergenic
1045204146 8:100019839-100019861 TTATAGTTCTTATACTGTCTTGG - Intronic
1045769106 8:105713393-105713415 TTAAGTTTCTTATAGATTCTGGG + Intronic
1045833436 8:106491975-106491997 CAGAGGTTCTCAAACTTTCTGGG + Intronic
1046090321 8:109495876-109495898 TTAAGGTTATTGAACTGACTTGG + Intronic
1047302533 8:123626192-123626214 TTATTGTTCTTTAGCTTTCTAGG + Intergenic
1047501368 8:125444402-125444424 GCAAGTTACTTAAACTTTCTGGG - Intergenic
1049966218 9:782462-782484 TTAAGTTTCTTATATATTCTGGG - Intergenic
1050236673 9:3588465-3588487 TTAAGCTTCTTCAACATTTTGGG - Intergenic
1050800451 9:9605792-9605814 TTCTGGTAATTAAACTTTCTTGG + Intronic
1051057192 9:13001493-13001515 TTATCAATCTTAAACTTTCTGGG + Intergenic
1052305072 9:26999037-26999059 TTAACTCTCTTAAACTCTCTGGG + Intronic
1052798018 9:32941852-32941874 TTAAGGTGCTAAAATTTTATTGG + Intergenic
1053213579 9:36252588-36252610 TTAAGGTTTTTTAGGTTTCTAGG - Intronic
1053388958 9:37719674-37719696 TTAAGTCTCTTAATCTCTCTAGG - Intronic
1053658762 9:40248474-40248496 TAAAGGCTCTGACACTTTCTCGG - Exonic
1053909136 9:42877743-42877765 TAAAGGCTCTGACACTTTCTCGG - Intergenic
1054359423 9:64099429-64099451 TAAAGGCTCTGACACTTTCTCGG - Intergenic
1054370883 9:64394748-64394770 TAAAGGCTCTGACACTTTCTCGG - Exonic
1054525836 9:66127748-66127770 TAAAGGCTCTGACACTTTCTCGG + Exonic
1054678512 9:67884496-67884518 TAAAGGCTCTGACACTTTCTCGG - Exonic
1054761651 9:69010337-69010359 TAAAGGTTCTTAACATTTCTTGG - Intergenic
1055978789 9:81980044-81980066 TGAAGGTTCTTAAAGTCTATTGG - Intergenic
1056035437 9:82600200-82600222 TTAAGGTTCTTATTCTGTCCAGG - Intergenic
1057882843 9:98806383-98806405 TTGTGCTTTTTAAACTTTCTGGG + Intergenic
1059089188 9:111337413-111337435 TTGAATTTCTTTAACTTTCTCGG - Intergenic
1059442468 9:114316549-114316571 TTAAAGTTCTTAAAATTTTTTGG - Intergenic
1059801238 9:117751678-117751700 TGAAGGTAGTCAAACTTTCTGGG + Intergenic
1060780844 9:126411351-126411373 TTTGGTTTCTTAAACTGTCTCGG + Intronic
1061292640 9:129660344-129660366 TTAAGGCTCCTAAACTCTTTAGG - Intergenic
1203694816 Un_GL000214v1:88181-88203 TAAAGGCTCTGACACTTTCTGGG + Intergenic
1203704730 Un_KI270742v1:29253-29275 TAAAGGCTCTGACACTTTCTCGG - Intergenic
1203559271 Un_KI270744v1:36560-36582 TAAAGGCTCTGACACTTTCTGGG + Intergenic
1203641457 Un_KI270751v1:15882-15904 TAAAGGCTCTGACACTTTCTGGG - Intergenic
1186778170 X:12886427-12886449 TTGATGTTCTTAAACCATCTTGG - Exonic
1187514906 X:19960124-19960146 TTAATTTTTTTTAACTTTCTTGG + Intronic
1191633303 X:63348946-63348968 TTAAAATTTTTAAACTTTTTAGG - Exonic
1192017788 X:67350279-67350301 TAAAGCTTCTTAATTTTTCTTGG + Intergenic
1192077378 X:68013322-68013344 GTAAGTTTCTTAACCTCTCTAGG - Intergenic
1192306993 X:69971691-69971713 TTAAGATACTTATAATTTCTAGG + Intronic
1193046097 X:77056170-77056192 TTAAGGTTTTTGAAGATTCTTGG - Intergenic
1193466707 X:81856734-81856756 TTAAAGGTCTTTAACTTCCTTGG - Intergenic
1195008163 X:100707718-100707740 TGAAGGGTCTTAAGTTTTCTTGG - Intronic
1195766448 X:108301078-108301100 TTAATTTTCTTAAACATTCTTGG + Intronic
1195902657 X:109815109-109815131 TTAAGGTTGTGTATCTTTCTTGG + Intergenic
1196221836 X:113120354-113120376 TTTAGGTTCTTAAAATAGCTTGG - Intergenic
1197086721 X:122485788-122485810 TTTAGGATATTTAACTTTCTAGG - Intergenic
1198789568 X:140329018-140329040 TTAATATTCTTGAACTTTCTAGG + Intergenic
1198888390 X:141364483-141364505 TTATGTTTGTTAAACTTTGTGGG - Intergenic
1199536649 X:148910332-148910354 TTTAGGTTCTACAACATTCTGGG + Intronic
1199621614 X:149706306-149706328 TTAGTCTTCTTAAACTTTTTGGG + Intronic
1199797801 X:151218498-151218520 ACAAGTTTCTTAACCTTTCTTGG - Intergenic
1200174591 X:154104497-154104519 TTAAGGCTATTAATTTTTCTAGG - Intergenic
1200968383 Y:9122790-9122812 AAAAGATGCTTAAACTTTCTTGG - Intergenic
1201262625 Y:12175405-12175427 TTAAAGGTCTTATAATTTCTGGG + Intergenic