ID: 1039517764

View in Genome Browser
Species Human (GRCh38)
Location 8:38147710-38147732
Sequence CATCACAGGGGACAGTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039517764_1039517771 16 Left 1039517764 8:38147710-38147732 CCTGGTTACTGTCCCCTGTGATG 0: 1
1: 0
2: 4
3: 19
4: 129
Right 1039517771 8:38147749-38147771 CAGAGAACCCCAGAAGGCCATGG No data
1039517764_1039517770 10 Left 1039517764 8:38147710-38147732 CCTGGTTACTGTCCCCTGTGATG 0: 1
1: 0
2: 4
3: 19
4: 129
Right 1039517770 8:38147743-38147765 CAAGCGCAGAGAACCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039517764 Original CRISPR CATCACAGGGGACAGTAACC AGG (reversed) Intronic
902506312 1:16940790-16940812 CATCACAGCTCACTGTAACCTGG + Intronic
908465639 1:64390903-64390925 GTTCAGAGGGGACAGAAACCAGG + Intergenic
909837302 1:80272901-80272923 AATCAATGGGGACAGTAACCTGG - Intergenic
911089493 1:94007175-94007197 CATCACAGGGGTTCTTAACCTGG + Intronic
911186530 1:94910059-94910081 AATCACTGGGGACAATAACCAGG - Intronic
911502533 1:98706135-98706157 CAGCACTGGGGAAAGAAACCAGG + Intronic
915854466 1:159367001-159367023 CACCACAGGGTTCAGTAACGGGG - Intergenic
917926516 1:179793785-179793807 CATCACTGAGGACAGCAACGGGG - Intronic
922455743 1:225772066-225772088 CATAACAGGGCACAGTACACTGG - Intergenic
923670652 1:236037848-236037870 CATCTCAGGGGACAGTCACTGGG - Intronic
1063949975 10:11213172-11213194 CATCAGAGGGGACAGTCCCTTGG - Intronic
1064097831 10:12436941-12436963 CAGCACAGGGGAGAGGCACCAGG + Intronic
1065811341 10:29446658-29446680 AATGGGAGGGGACAGTAACCTGG + Intergenic
1069579819 10:69558525-69558547 CATTGCAGAGGACAGTACCCAGG + Intergenic
1071747829 10:88441966-88441988 CACCATAGGGGATAGTAACCCGG - Intronic
1072052222 10:91716603-91716625 AACCACATGGGACTGTAACCTGG - Intergenic
1072894838 10:99357984-99358006 GAACACAGGGGACAGAAACAAGG - Intronic
1075539477 10:123300115-123300137 CAGCCCAGGGGACAGAAAGCTGG + Intergenic
1076621553 10:131792358-131792380 CACCACTGGGGACAGGAAACTGG + Intergenic
1078247243 11:9585098-9585120 CATCTCAGGGGACAGAAACCAGG - Intronic
1080431086 11:32200597-32200619 AATCTCAGGCGACAGTCACCTGG - Intergenic
1080651985 11:34230160-34230182 CATCACAGGGAACTGTAAAGAGG - Intronic
1085990100 11:81831056-81831078 CATCACAGGGGGCTGTAAACTGG + Intergenic
1090583843 11:128188543-128188565 CATCACAGAGCACAGTCAACAGG - Intergenic
1090794642 11:130124185-130124207 CATCACAGGGGTCAGTGACAGGG - Intronic
1092526858 12:9314795-9314817 CACTACAGGGGACAGGAACACGG - Intergenic
1092540415 12:9416984-9417006 CACTACAGGGGACAGGAACACGG + Intergenic
1094308698 12:29052559-29052581 CATCATATGGCACAGTATCCAGG + Intergenic
1094512633 12:31105495-31105517 CACTACAGGGGACAGGAACACGG - Intergenic
1097183564 12:57184498-57184520 CATCACAGGGAACAGGAGCCTGG - Intronic
1097441716 12:59615960-59615982 CATTACAGGGAACAGTCACCAGG - Intronic
1107785151 13:43948115-43948137 CATCACAGGAGACAGAAAGCTGG + Intergenic
1108381487 13:49859081-49859103 TCTCACAAGGGACAGAAACCAGG - Intergenic
1108712165 13:53044234-53044256 CATTGCAGGGCACAGTAATCTGG - Intronic
1114655853 14:24315198-24315220 CATCTCTGGGGACAGTAGGCAGG + Intronic
1115358054 14:32470553-32470575 CATCTCTGGGGAAAGTAATCAGG + Intronic
1118729405 14:68655923-68655945 CCTCACAGCAGACAGGAACCAGG + Intronic
1121442841 14:93959555-93959577 CATCACAGGCGAGAGGAGCCTGG + Intronic
1122751975 14:103942661-103942683 CACTAGAGGGGACAGTGACCCGG - Intronic
1123075706 14:105666437-105666459 CAGCACAGGGGACAGTGTCAGGG + Intergenic
1123892793 15:24798233-24798255 CAATAAAGGGTACAGTAACCGGG - Intergenic
1124585346 15:31000572-31000594 GATCACTGGGTAGAGTAACCAGG - Intergenic
1127184654 15:56465513-56465535 CAGCAAAGGGGACAGCGACCTGG - Intergenic
1127653055 15:61028093-61028115 CTTCACATCTGACAGTAACCTGG + Intronic
1128153369 15:65377262-65377284 CAAGACAGGGGACAGCAGCCTGG - Intronic
1128675835 15:69607816-69607838 AACCACAAGGGACAGTACCCAGG + Intergenic
1129765134 15:78160059-78160081 CATCACAGAGCACAGTGAGCTGG - Intronic
1135584560 16:23658909-23658931 CCTCACAAGGGACCGGAACCTGG + Intronic
1136537110 16:30906366-30906388 CTTCACAGGGGCCAGAAATCTGG + Intergenic
1137546802 16:49410440-49410462 CTTCCCAGGGGACAGCAACAAGG - Intergenic
1139393154 16:66618844-66618866 CCTGCCAGGGGACAGTAACAGGG + Intronic
1142467405 17:144124-144146 CATTCCAGGTGTCAGTAACCAGG - Intergenic
1144849179 17:18235478-18235500 CATCACTGGGGGCCGAAACCTGG + Exonic
1149088628 17:52751234-52751256 CTTCCCTGGGGACAGGAACCAGG + Intergenic
1149772857 17:59334476-59334498 CATCACAATGGGAAGTAACCAGG - Intronic
1153278239 18:3390172-3390194 CATCACTGGGGACAGAAAACCGG - Intergenic
1154385646 18:13889551-13889573 CATCACAGGGCACAAGAACATGG + Intronic
1155443299 18:25884466-25884488 CATCACAGCGGAAAGAAACACGG + Intergenic
1157807009 18:50665644-50665666 CATCACAGGGGGCAGGGAGCAGG + Intronic
1158365231 18:56726866-56726888 GATTACAGGGTACAGTACCCAGG - Intronic
1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG + Exonic
1161937443 19:7380888-7380910 GATCAGAGGGGACAGATACCTGG - Intronic
1162192421 19:8957384-8957406 CATCACAGGGTACCCTTACCTGG - Exonic
1162432633 19:10638131-10638153 CATCACAGAAGACAGAAATCAGG - Intronic
1163713561 19:18861198-18861220 CATCACAGGGATCAGAAACATGG + Intronic
1164099355 19:22040955-22040977 CATTACAGGGCACACTAAACAGG - Intergenic
1164119546 19:22253836-22253858 CATTACAGGGCACACTAAACAGG - Intergenic
1167660826 19:50794961-50794983 CAACACAGAGGACTGTCACCTGG - Exonic
1167837791 19:52088688-52088710 CATCACGGGGCACATTAAGCAGG - Intronic
925998821 2:9313740-9313762 CATCTCAGGGGTTAGTAACTGGG + Intronic
926541138 2:14182721-14182743 CCTCCCAGGGTACAGGAACCTGG - Intergenic
929576980 2:43058062-43058084 CCTCACAGGAGACAGAAAGCAGG - Intergenic
930027965 2:47041051-47041073 CATCCCAGGGGACAGTCACTGGG - Intronic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
942714569 2:178877037-178877059 CAACACAGAGTACAGTAAACTGG - Intronic
942892761 2:181012131-181012153 CATCACAAGTGACAAAAACCTGG - Intronic
944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG + Intergenic
944889507 2:204102771-204102793 CATCCCAGAAGACAGTATCCAGG + Intergenic
945123479 2:206483810-206483832 AATGAGAGGGGACAGAAACCGGG + Intronic
1170052786 20:12165037-12165059 GATCTCAGGGAACAGAAACCTGG + Intergenic
1172247450 20:33455746-33455768 AAACACAGGGGATAGAAACCAGG + Intergenic
1184224789 22:43123336-43123358 CAGCACAGGGGACAGAGGCCAGG - Intronic
1184293966 22:43512320-43512342 CCTATCAGGGGACAGTAACCAGG - Intergenic
967620570 3:191628843-191628865 CATCTCAGGGAACAGTTTCCTGG - Intergenic
968276026 3:197441033-197441055 ATTCACAGGGGACAGTAAGAGGG - Intergenic
969097922 4:4748037-4748059 CTTCACAGGAGAGAGGAACCAGG - Intergenic
970044099 4:11830319-11830341 CATCACAGGGGTCTATACCCTGG + Intergenic
980867077 4:138564391-138564413 TATCACAGGGCACAGTAACAGGG + Intergenic
981585484 4:146297201-146297223 CTTCACAGGGAAAAGTAAACAGG - Intronic
986807616 5:11323569-11323591 CATGACAGGGTACAGGATCCTGG + Intronic
994465277 5:100120405-100120427 CATCACAGTAGAAAGTGACCTGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1002818217 6:698194-698216 CATCCCAGGGGCCAGGACCCTGG - Intergenic
1003490473 6:6616846-6616868 CTTGACAGGGGACAGAAACAGGG - Intronic
1003641385 6:7878395-7878417 CAGCACAGGGGCCACTAGCCTGG - Intronic
1004075951 6:12344341-12344363 CAGCAGAGGGGACAGTACCCAGG + Intergenic
1005776601 6:29138914-29138936 GATGACAGGGTGCAGTAACCTGG + Intergenic
1007449668 6:41933220-41933242 CATCACAGGCTACAGCAGCCAGG + Intergenic
1008112786 6:47511181-47511203 TATCACTGGTGACATTAACCTGG - Intronic
1012376331 6:98565826-98565848 CATCCCAGAGGACACTAAACTGG + Intergenic
1013968363 6:115983849-115983871 CTTTAAAGGGGACAGTAACAAGG - Intronic
1015935489 6:138403605-138403627 CGCCGCAGGGGACAGTAACGCGG + Intronic
1016901770 6:149109820-149109842 CACCACAGAGGACAATATCCTGG - Intergenic
1018603285 6:165569745-165569767 CTACACAGGGAACAGTAAACCGG - Intronic
1018914271 6:168123251-168123273 TATCACAGCGGACAGCACCCCGG + Intergenic
1019314530 7:378373-378395 AATCACTGGGAACAGTAAACCGG + Intergenic
1022249830 7:28596102-28596124 CATCACTGAGGAGAGTCACCTGG - Intronic
1023034104 7:36115866-36115888 CATCCCAGGGGAAAGTAGCTAGG + Intergenic
1023499289 7:40830784-40830806 CAGCACAGAAGACAGTAACTCGG + Intronic
1023569061 7:41553665-41553687 CAGCACAGGGGAATGTACCCTGG - Intergenic
1025156868 7:56614824-56614846 CATAGCAGGGAACAGCAACCAGG - Intergenic
1025759849 7:64379649-64379671 CATAACAGGGACCAGCAACCAGG + Intergenic
1026573296 7:71551056-71551078 AATCCCAGAGGACAGTAAACAGG - Intronic
1027990076 7:85347339-85347361 CAGTACAGGTGACAGAAACCAGG - Intergenic
1031515599 7:122694492-122694514 CATCACGGGACACAGTAACTTGG + Intronic
1032482595 7:132258593-132258615 GATCACAGGGGACAGGAAGGAGG - Intronic
1032719174 7:134536862-134536884 CATCTCAGGGGTCAGTGATCAGG + Intronic
1035813667 8:2515146-2515168 CATCCCAGGGCAGAGTATCCTGG - Intergenic
1039517764 8:38147710-38147732 CATCACAGGGGACAGTAACCAGG - Intronic
1040375000 8:46816502-46816524 CATAACAGGGAACAGCAACCAGG + Intergenic
1040377952 8:46844700-46844722 CATACCAGGGAACAGCAACCAGG + Intergenic
1041007094 8:53505936-53505958 CATCACAGCTCACTGTAACCTGG + Intergenic
1042473651 8:69220190-69220212 CATAAAAGGGGACAATCACCTGG - Intergenic
1042512977 8:69630663-69630685 GATCGCTGGGGACAGTAACTGGG + Intronic
1044868632 8:96597012-96597034 CATGACAGAGGAAAGGAACCAGG - Intronic
1049670572 8:143867820-143867842 CTTCACAGAGGACAGGAAGCGGG - Exonic
1051654924 9:19370386-19370408 GATCACAGCTGACTGTAACCTGG - Intronic
1052184578 9:25576792-25576814 CATCAGAGGGGTCAGAATCCGGG - Intergenic
1056561279 9:87732167-87732189 TATCACAGAGGAGGGTAACCAGG + Intergenic
1057405809 9:94769769-94769791 CATCAAGGGGGTCAGTTACCTGG - Intronic
1060860030 9:126946609-126946631 AATCACAGTGCACAGTAGCCAGG - Intronic
1060990466 9:127846119-127846141 CATCCCAGAGGACCGTCACCTGG - Intronic
1190684104 X:52855143-52855165 AAAGACAGGGGAAAGTAACCAGG - Intergenic
1193485973 X:82085980-82086002 CATCACATGGGACAGGAATGAGG - Intergenic
1195654788 X:107324069-107324091 CCTCCCAGGGCACAGGAACCTGG - Intergenic
1196070470 X:111515761-111515783 AATCTCTGGGGACAGTATCCTGG - Intergenic
1197081381 X:122421922-122421944 CATTACAGGGAACAGTCACCAGG - Intergenic
1200843378 Y:7806541-7806563 CATAACAGGGAAAAGCAACCAGG - Intergenic
1200843967 Y:7812531-7812553 CATAACAGGCACCAGTAACCAGG - Intergenic
1202244897 Y:22810222-22810244 CATAACAGGGAACAGCAACCAGG + Intergenic
1202248117 Y:22840315-22840337 CATAACAGAGAACAGCAACCAGG + Intergenic
1202262396 Y:22983438-22983460 CATCACTGGATGCAGTAACCAGG + Intronic
1202267825 Y:23039479-23039501 CATAACAGGGAACAGTAACCAGG + Intergenic
1202336284 Y:23814100-23814122 CATCCCAGGCCACAGGAACCAGG - Intergenic
1202397886 Y:24443968-24443990 CATAACAGGGAACAGCAACCAGG + Intergenic
1202401105 Y:24474063-24474085 CATAACAGAGAACAGCAACCAGG + Intergenic
1202415386 Y:24617179-24617201 CATCACTGGATGCAGTAACCAGG + Intronic
1202420817 Y:24673223-24673245 CATAACAGGGAACAGTAACCAGG + Intergenic
1202449969 Y:24996859-24996881 CATAACAGGGAACAGTAACCAGG - Intergenic
1202455401 Y:25052907-25052929 CATCACTGGATGCAGTAACCAGG - Intronic
1202469675 Y:25196023-25196045 CATAACAGAGAACAGCAACCAGG - Intergenic
1202472895 Y:25226119-25226141 CATAACAGGGAACAGCAACCAGG - Intergenic
1202534482 Y:25855967-25855989 CATCCCAGGCCACAGGAACCAGG + Intergenic