ID: 1039518317

View in Genome Browser
Species Human (GRCh38)
Location 8:38151143-38151165
Sequence CAGGGCCAGGCGAGGGATGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1619
Summary {0: 1, 1: 0, 2: 11, 3: 150, 4: 1457}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039518298_1039518317 29 Left 1039518298 8:38151091-38151113 CCGTTTGTGGGGAGCTTGGGGCG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1039518317 8:38151143-38151165 CAGGGCCAGGCGAGGGATGGAGG 0: 1
1: 0
2: 11
3: 150
4: 1457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039518317 Original CRISPR CAGGGCCAGGCGAGGGATGG AGG Exonic
900033465 1:387934-387956 CAGGCCCAGATGAGGGAAGGGGG + Intergenic
900054303 1:617823-617845 CAGGCCCAGATGAGGGAAGGGGG + Intergenic
900074331 1:800738-800760 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
900090144 1:916671-916693 CAGGGCCTGGCGGGAGCTGGTGG - Intergenic
900132192 1:1091886-1091908 CAGGGCCACGACAGGGAAGGTGG + Intronic
900158159 1:1211798-1211820 CAGGCCCAGGCCCAGGATGGCGG + Exonic
900177247 1:1296339-1296361 GAGGGCCAGGCCGGGGGTGGGGG - Intronic
900177269 1:1296392-1296414 GAGGGCCAGGCTGGGGGTGGGGG - Intronic
900371853 1:2335762-2335784 CGGGGCCAGGCGAGGGCTGGTGG + Intronic
900400385 1:2470655-2470677 CATAGCCAGGCGCGGGAGGGAGG - Intronic
900485992 1:2923095-2923117 CAGGGCCTGGGCAGGGTTGGGGG - Intergenic
900486013 1:2923162-2923184 CAGGGCCTGGGCAGGGCTGGGGG - Intergenic
900488981 1:2936965-2936987 CTGGGGGAGGCCAGGGATGGGGG - Intergenic
900505360 1:3027616-3027638 CAGGGGCAGGCGGGGGGGGGGGG + Intergenic
900528385 1:3140462-3140484 CAGAGACAGGCGAGGGGTGGGGG - Intronic
900562628 1:3315023-3315045 CAGGGGCTGGGGAGGGAGGGTGG - Intronic
901763071 1:11483087-11483109 CGGGACCAGTCCAGGGATGGCGG + Intronic
901766338 1:11502295-11502317 CAGACCCAGGTGAAGGATGGTGG + Intronic
902328274 1:15716963-15716985 CAGCACCAGGCCAGGCATGGTGG + Intronic
902752782 1:18528890-18528912 AGGGGCCAGGAAAGGGATGGAGG - Intergenic
902923490 1:19680816-19680838 GAGGGCCAGGCCAGGCATGGAGG - Intergenic
903293416 1:22329004-22329026 CAGGGCCAGGCCAGGGCTGGGGG - Intergenic
903358290 1:22761664-22761686 GAGGTCCAGGAGAGGGAAGGAGG - Intronic
903606314 1:24577560-24577582 CAAGGCCAGGCCGGGCATGGTGG - Intronic
903739560 1:25550804-25550826 AAGGGTCAGGCCAGGGAAGGAGG + Intronic
903846234 1:26281170-26281192 CATGGCCAGGTGAAGGCTGGGGG - Exonic
904049720 1:27631901-27631923 CGGGGGCAGGCCAGGGCTGGAGG + Intronic
904095162 1:27971304-27971326 CAGTGCCTGGCCAGGCATGGTGG + Exonic
904153416 1:28462294-28462316 AAGGGCCAGGCCAGGCATGGTGG - Intronic
904156355 1:28486577-28486599 AAGGCCCAGGCCAGGCATGGTGG + Intronic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904604825 1:31692562-31692584 CAGGGATAGGGCAGGGATGGTGG - Intronic
904611649 1:31729115-31729137 GAGGGCCAGGAGAGGCATGAGGG - Intronic
905221450 1:36450652-36450674 GAGGGCCGGGCCAGGGCTGGGGG + Intergenic
905297116 1:36961264-36961286 CAGGCCCAGGCTAGGGGTGAAGG + Intronic
905750198 1:40455759-40455781 CAGGGCCTGTCAGGGGATGGGGG - Intronic
905941406 1:41866285-41866307 CAGGGACAGGGGATGCATGGTGG + Intronic
906032909 1:42734792-42734814 CAAGGCCAGGCTTGGGAGGGGGG + Exonic
906094097 1:43208632-43208654 CGGGGCCTGTCGTGGGATGGGGG + Intronic
906208377 1:43998965-43998987 GAGGGCCTGGCGGGGGAAGGGGG + Intronic
906251126 1:44311776-44311798 CAGGTCCTGGCTGGGGATGGTGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906338508 1:44956352-44956374 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
906355391 1:45101878-45101900 CAGGGCCTGTCGTGGGGTGGAGG + Intronic
906408638 1:45561870-45561892 CCTGGTCAGGTGAGGGATGGGGG + Exonic
906636828 1:47415869-47415891 GAAGGCCAGGAGAAGGATGGGGG + Intergenic
906756612 1:48323406-48323428 CAGGACCTGTCGAGGGGTGGGGG + Intronic
906945592 1:50291714-50291736 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
907185026 1:52602719-52602741 CCGGGCCGGGCGCGGGATGGGGG - Intronic
907323852 1:53622663-53622685 CATGGCCAGGAGACGGATGCTGG + Intronic
907902291 1:58751901-58751923 CAGGGCTAGGCTGGGCATGGTGG + Intergenic
907979469 1:59467336-59467358 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
907999720 1:59668353-59668375 CAGGGCAAGGGGAGGGAAAGTGG + Intronic
908102255 1:60803671-60803693 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
908247517 1:62239667-62239689 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
908292408 1:62681373-62681395 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
908519824 1:64930986-64931008 CAGGGCCAGTCAGGGGGTGGGGG + Intronic
909040113 1:70639364-70639386 CAGGGCCTGTCGTGGGATGAGGG + Intergenic
909142305 1:71883728-71883750 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
909533559 1:76708236-76708258 TAGTGCCAGGCCAGGCATGGTGG + Intergenic
909588081 1:77313572-77313594 GAGGGCCGGGCTAGGGAGGGAGG - Intronic
910223160 1:84909446-84909468 CAGGGCCTGTCGAGGGGTTGGGG + Intergenic
910266908 1:85347604-85347626 CGGGGCCTGTCGTGGGATGGGGG + Intronic
910310626 1:85820133-85820155 CAAGGGCAGGCCAGGCATGGTGG - Intronic
910560799 1:88588597-88588619 CAGGGCCAGTCGGGGAGTGGGGG + Intergenic
910600652 1:89028672-89028694 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
910710318 1:90172817-90172839 CAGGGCCTGTTGTGGGATGGTGG + Intergenic
911144377 1:94538583-94538605 CAGAGCCACCTGAGGGATGGTGG + Intronic
911555847 1:99343537-99343559 CAGAGCCTGTCAAGGGATGGGGG + Intergenic
911854529 1:102860000-102860022 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
912091944 1:106089104-106089126 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
912235935 1:107850559-107850581 CAGGGCCTGTCGAGGGGTGGGGG + Intronic
912261647 1:108116680-108116702 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
912519464 1:110235238-110235260 CTGGGCCAGCCGAGGCAAGGGGG + Intronic
912734349 1:112136814-112136836 CGGGGCCTGTCAAGGGATGGGGG - Intergenic
912884402 1:113454648-113454670 CGGGGCCTGTCGAGGGATGGGGG - Intronic
912900356 1:113640713-113640735 CAGGGCCAGTCGGGGGTTGGGGG + Intronic
913018353 1:114762587-114762609 CAGGGCCTGTCGTGGGATGGGGG + Intergenic
913033677 1:114938386-114938408 CAGGGCCTGTTGTGGGATGGGGG + Intronic
913341680 1:117764127-117764149 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
913401367 1:118438156-118438178 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
914196241 1:145449480-145449502 CAGGGGCAGGAGGGAGATGGAGG - Intergenic
915474833 1:156147332-156147354 CAGGGCCAGGCATGGCAGGGAGG - Intergenic
915514766 1:156406349-156406371 CAGGGCCTGGGAAGGGGTGGTGG + Intronic
915618702 1:157064509-157064531 CAGGGCCTGTCGGGGGTTGGGGG - Intergenic
915854213 1:159363806-159363828 TAGGACCAGTCTAGGGATGGAGG - Intergenic
916233287 1:162561470-162561492 CGGGGCGGGGCTAGGGATGGGGG - Intergenic
916768781 1:167887533-167887555 CAGGGCCTGTCGTGGGCTGGGGG + Intronic
916844773 1:168638488-168638510 CCGGGCCAGCCCAGGGATGGAGG + Intergenic
916951044 1:169780698-169780720 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
917320675 1:173778224-173778246 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
917489540 1:175486277-175486299 CAGGGCCTGTCGAGGGGTGGGGG - Intronic
917817605 1:178725859-178725881 CAGGGCCAGGGGAGGGGGTGTGG - Intronic
917880223 1:179328222-179328244 CAAAGCTAGGCCAGGGATGGTGG - Intronic
917884959 1:179374813-179374835 CGGGGCCTGTCGTGGGATGGGGG + Intronic
918142773 1:181732727-181732749 CAGGGCCTGGCCAGCCATGGTGG - Exonic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918311960 1:183291375-183291397 CAGGGCCTGGCTAGGGATCTAGG - Intronic
919140929 1:193570893-193570915 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
919180770 1:194078377-194078399 CAGGGCCTGTCGAGGGGTGGGGG + Intergenic
919262997 1:195221962-195221984 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
919293803 1:195668590-195668612 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
919325804 1:196105322-196105344 CGGGGCCAGTCGTGGGATGGGGG + Intergenic
920055256 1:203186457-203186479 CAGAGCCAGGGGAGGGACTGAGG - Intronic
920096338 1:203488690-203488712 CTGGGCCAGGCAATGGAGGGTGG - Exonic
920243722 1:204572618-204572640 GAGGGCCGGGGGAGGGGTGGTGG + Intergenic
920370297 1:205474631-205474653 CAGGGGTTGGAGAGGGATGGGGG - Intergenic
920808042 1:209253516-209253538 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
920948926 1:210554777-210554799 GAGGGTCAGGAGAGAGATGGAGG + Intronic
921793891 1:219320593-219320615 CAGGACCTGTCGTGGGATGGGGG - Intergenic
921872256 1:220153754-220153776 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
921962756 1:221053374-221053396 CAGTGCCTGTCGAGGGGTGGGGG + Intergenic
922180034 1:223226345-223226367 CTGGGCCTGGGGAGGGATGCAGG + Intronic
922228716 1:223667446-223667468 CAAGGCCAGGCCAGGCATGGTGG + Intergenic
922344627 1:224686159-224686181 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
922440514 1:225652589-225652611 CCGGGCCGGGAGAGGGAAGGCGG + Intronic
922716612 1:227878124-227878146 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
923250997 1:232179800-232179822 CAGGGCCAGACCAGGCATGTGGG - Intergenic
923422287 1:233828218-233828240 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
924160271 1:241224249-241224271 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
924175170 1:241384223-241384245 CAGGGTCTGGCCAGGCATGGTGG + Intergenic
924265024 1:242273079-242273101 CAGGGCCTGTTGGGGGATGGGGG - Intronic
924337020 1:242994953-242994975 CAGGCCCAGATGAGGGAAGGGGG + Intergenic
924487438 1:244499496-244499518 CATGGCCTGTCGAGGGGTGGGGG - Intronic
924836579 1:247654269-247654291 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
924885832 1:248215502-248215524 CGGGGCCTGTCGGGGGATGGGGG + Intergenic
1063102568 10:2963257-2963279 CAGGCCCAGGAGATGGAGGGTGG - Intergenic
1063297839 10:4825404-4825426 CAGGGCCAGTGGAGGGAAAGAGG - Intronic
1063723452 10:8609816-8609838 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1064356214 10:14620684-14620706 CAGGGCCTGTGGGGGGATGGCGG - Intronic
1064530680 10:16306451-16306473 CAGGGCCTGTCGGGGGATTGGGG - Intergenic
1064588049 10:16859483-16859505 GATGACCAGGGGAGGGATGGGGG + Intronic
1064939649 10:20719658-20719680 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1065452184 10:25870493-25870515 TAGGGTCAGGAGAGGGAAGGAGG + Intergenic
1065812972 10:29459528-29459550 TGGGGCCAGGGGAGGGAAGGGGG - Intronic
1065815642 10:29480255-29480277 CAGGGGCAGGGGAGGGAGAGAGG + Intronic
1065957289 10:30704949-30704971 CAGGGGCAGGGGAGGGAGAGAGG - Intergenic
1066719785 10:38325411-38325433 CAGGGCCTGCTGGGGGATGGGGG + Intergenic
1066956935 10:42182037-42182059 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1067127035 10:43527319-43527341 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1067256278 10:44645615-44645637 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1067513074 10:46911493-46911515 CAGGCCCAGGTGAGGAAAGGTGG + Intronic
1067649179 10:48140349-48140371 CAGGCCCAGGTGAGGAAAGGTGG - Intergenic
1067741150 10:48896977-48896999 CAGCGCCAGGCTGGGCATGGGGG + Intronic
1068002388 10:51350918-51350940 CAGGGCCTGTCAGGGGATGGGGG - Intronic
1068159157 10:53241521-53241543 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1068197152 10:53731671-53731693 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1068270739 10:54719680-54719702 CGGGGCCAGTCGGGGGGTGGCGG - Intronic
1068274874 10:54781318-54781340 TAGGGCCTGTCGGGGGATGGTGG - Intronic
1068548949 10:58385166-58385188 CCGGGCCAGGAGGGTGATGGAGG - Exonic
1068602422 10:58969716-58969738 GAGGGACAGGAGAGGGATTGTGG + Intergenic
1068620633 10:59177200-59177222 CCGGGCCAGGCGGGCGAAGGCGG - Intronic
1068622636 10:59203755-59203777 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1068795350 10:61073264-61073286 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1068967987 10:62933057-62933079 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1069337199 10:67366196-67366218 CAGGGCCTGTCGGGGGTTGGGGG + Intronic
1069527801 10:69188784-69188806 CAAGTACAGGCGAGGCATGGTGG - Intronic
1069635417 10:69921976-69921998 CAGGGCCAGGTATGGGATGTGGG - Intronic
1069902878 10:71715993-71716015 CAGGGGCTGTCGAGGGACGGTGG + Exonic
1070233904 10:74603411-74603433 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1070256103 10:74814106-74814128 CAGGGGATGGCAAGGGATGGCGG + Intergenic
1070268744 10:74931234-74931256 CAGGGACAGGAGAGGAAAGGAGG - Intronic
1070359279 10:75671624-75671646 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1070566249 10:77605720-77605742 CAGGGCCTGGCCTGGGATGTGGG - Intronic
1070747317 10:78941877-78941899 CAGGGCCTGGCAGGGGAGGGAGG + Intergenic
1070793558 10:79203863-79203885 CCGGGGCAGGTGAGGGAGGGTGG - Intronic
1070830065 10:79412655-79412677 CAGGGCCACATGATGGATGGTGG - Intronic
1070850992 10:79561308-79561330 CTGGGCCAGGTGTGGAATGGGGG + Intergenic
1070856207 10:79609966-79609988 CTGGGCCAGGTGTGGAATGGGGG - Intergenic
1070875141 10:79797229-79797251 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1071005105 10:80875173-80875195 CAGGGCCTGTCGAGGGGTAGGGG - Intergenic
1071026298 10:81117882-81117904 CAGGGCCAGTCCATGGCTGGGGG + Intergenic
1071149039 10:82611421-82611443 CAGGGCCTGTCCAGGGGTGGAGG - Intronic
1071211876 10:83351039-83351061 CAGGGCCTGTTGGGGGATGGCGG - Intergenic
1071350290 10:84733731-84733753 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1071565076 10:86667541-86667563 CAGGGCCAGGAGGGGCAGGGAGG - Intergenic
1071601253 10:86959686-86959708 CAGGGCCAGGGGACACATGGGGG + Intronic
1071642069 10:87319399-87319421 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1072017781 10:91366288-91366310 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1072161645 10:92772191-92772213 AAGGGCCTGGGGAGGGATGGAGG + Intergenic
1072215768 10:93286080-93286102 CAGGGACAGGCCAGGCACGGTGG - Intergenic
1072454867 10:95567019-95567041 CTGGGCAAGGCCAGGCATGGTGG + Intergenic
1072615662 10:97047651-97047673 TAGGGACAGGGGAGGGCTGGGGG + Intronic
1072669348 10:97417820-97417842 CAGGGACAGGCCAGGCACGGTGG - Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072886946 10:99285559-99285581 AAGGGAAAGGTGAGGGATGGAGG + Intergenic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1073599160 10:104830055-104830077 CAGGGCCTGTCGGGGGTTGGGGG - Intronic
1074185123 10:111094448-111094470 CAGGGTCATGTGTGGGATGGAGG + Intergenic
1074298003 10:112209015-112209037 CAGGGCAAGGACAGGGATTGGGG + Intronic
1074305990 10:112278905-112278927 CAGGGTCAGCTGAGAGATGGGGG + Intergenic
1074473369 10:113747138-113747160 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1074673748 10:115825269-115825291 CAGGGCCTGTCGGGGGTTGGGGG + Intronic
1074680276 10:115899109-115899131 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1074690767 10:116002158-116002180 CAGGGCCGGCAGGGGGATGGTGG + Intergenic
1074729493 10:116354434-116354456 CAGCTCCAGGCCAGGCATGGTGG + Intronic
1074756473 10:116627673-116627695 CCGGGCCCTGCCAGGGATGGGGG - Intronic
1074794933 10:116933320-116933342 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1074860616 10:117507278-117507300 CAGGGAGGGGCGAGGCATGGTGG - Intergenic
1074981982 10:118627178-118627200 GAGGCCCAGGAGTGGGATGGCGG - Intergenic
1075133209 10:119758298-119758320 CAGGGCCAGGGGTGGGAGCGGGG + Intronic
1075380943 10:122018125-122018147 CAGGGCCTGTTGGGGGATGGGGG - Intronic
1075417784 10:122278104-122278126 CAGGGCTCGGCCAGGGATGCAGG + Intronic
1075430320 10:122374856-122374878 CGGGGCCAGGCGCGAGGTGGCGG + Intronic
1075521525 10:123146461-123146483 CAGGGGCAGGCGAGGGGGCGGGG - Intergenic
1075525228 10:123178756-123178778 CAGGGCCTGTCGAGGGGTGGGGG + Intergenic
1075565077 10:123497398-123497420 AATGGCCAGGCGAGGCATGTTGG - Intergenic
1075624309 10:123950829-123950851 CAGGGCCAGGTGTGGGTTTGGGG - Intergenic
1075660036 10:124187100-124187122 CAGGGCCAGCTGTGGGCTGGGGG - Intergenic
1075679064 10:124319544-124319566 CAGGGCCTGTTGTGGGATGGGGG - Intergenic
1075909523 10:126112211-126112233 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1075936152 10:126343181-126343203 CAGGGCCTGTCGTGGGATGGGGG - Intronic
1075979153 10:126722289-126722311 CAGGGCCAGCTGGGGGATGGAGG + Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076542617 10:131223823-131223845 GAGGGCCAGGGGAGGGTTCGTGG - Intronic
1076690819 10:132223114-132223136 CAGGGCCACGCGAGGAAGGGTGG + Intronic
1076863860 10:133157894-133157916 CAGGGCCTGGGCAGGGAGGGAGG + Intergenic
1076907904 10:133372668-133372690 CAGAGCCAGGCAGGGGGTGGGGG + Intronic
1077023621 11:430449-430471 GAGGGACAGGAAAGGGATGGGGG + Intronic
1077286481 11:1768201-1768223 CAGGGGCAAGCAAGGGCTGGAGG + Intergenic
1077287240 11:1773053-1773075 CAGGCACAGGCGAGGTTTGGGGG + Intergenic
1077289751 11:1783571-1783593 CAGGGCCCAGCCAGGGATGGGGG - Intergenic
1077302143 11:1852319-1852341 CAGCCCGAGGGGAGGGATGGAGG - Intergenic
1077306089 11:1869247-1869269 CCGGGCCTGGCCAGGGATGCTGG + Intronic
1077386206 11:2270667-2270689 GAGGGCGAGGCGAAGGAAGGAGG - Exonic
1077485910 11:2838366-2838388 CAGAGTGAGGCCAGGGATGGGGG + Intronic
1077945016 11:6887731-6887753 CGGGGCCTGTCGGGGGATGGAGG - Intergenic
1077960004 11:7065861-7065883 CAGGGCCTGTTGGGGGATGGGGG - Intronic
1077987507 11:7368518-7368540 CAGGGCCTGTCAGGGGATGGGGG - Intronic
1078031227 11:7753397-7753419 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
1078037263 11:7820429-7820451 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1078086101 11:8233753-8233775 CAGAGCCAGGCTGGGGAAGGAGG - Intronic
1078120210 11:8499908-8499930 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1078312950 11:10264737-10264759 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1078382867 11:10859796-10859818 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1078813523 11:14796028-14796050 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1078990154 11:16638058-16638080 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
1079077413 11:17392839-17392861 CAGGGGCTGGCGGTGGATGGTGG - Intergenic
1079113382 11:17621551-17621573 CAGGGTCAGGACAGGGTTGGAGG + Intronic
1079310679 11:19363134-19363156 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1079396841 11:20071108-20071130 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1079440916 11:20513874-20513896 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1079451321 11:20601773-20601795 CAGTGCCAGGTGATGGATGCGGG + Intronic
1079828417 11:25229799-25229821 CAGGGCCTGTCGTGGGGTGGAGG - Intergenic
1080179122 11:29401551-29401573 CAGGGCCTGTTGTGGGATGGGGG + Intergenic
1080834796 11:35930078-35930100 CCAGGCCAGGCCAGGCATGGTGG + Intergenic
1080866312 11:36198571-36198593 CAGAGGCAGGAGTGGGATGGGGG - Intronic
1081081065 11:38739896-38739918 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1081378067 11:42382788-42382810 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1081410434 11:42751563-42751585 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1081582983 11:44365205-44365227 CAGAACCAGGCTGGGGATGGGGG - Intergenic
1081611738 11:44567071-44567093 CAGGGACATGGTAGGGATGGGGG - Intronic
1081757808 11:45557059-45557081 AGGTGCCAGGCGTGGGATGGGGG + Intergenic
1081812660 11:45922463-45922485 CAGGACGAGGGGAGGGCTGGGGG - Intronic
1082129703 11:48472902-48472924 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1082579057 11:54844258-54844280 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1082724514 11:56719168-56719190 CAGGGACAGGCAAGAGACGGTGG - Intergenic
1082792352 11:57355101-57355123 CAGGGCAGGGCGAGGAAGGGAGG + Intronic
1082835820 11:57649508-57649530 CAGAGCTTGGAGAGGGATGGAGG + Exonic
1082951843 11:58825301-58825323 CAGGGCCTGTCGGGGGCTGGGGG - Intergenic
1082988378 11:59186748-59186770 CAGGGCCAGGCATGGTATGGTGG - Intronic
1083078753 11:60068856-60068878 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1083186790 11:61022285-61022307 CAGGGCGGGGCAAGGGTTGGGGG + Intergenic
1083500130 11:63097907-63097929 CAGGGCCTGTTGGGGGATGGGGG + Intronic
1083585481 11:63855229-63855251 CAGGACGAGGCCAGGCATGGTGG + Intronic
1083653929 11:64220025-64220047 CAGGGCCAGGGGCTGGGTGGGGG + Intronic
1083722385 11:64609747-64609769 CTGGGCCTGACGAGGGTTGGAGG + Intronic
1083991096 11:66246249-66246271 CACAGCCAGGCGAGGGCTGCAGG + Intergenic
1084084730 11:66849797-66849819 CAGATCCAGGGGAGGGAGGGAGG + Exonic
1085133789 11:74065902-74065924 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1085368244 11:75973710-75973732 CAGGGCCTGTCGTGGGTTGGGGG - Intronic
1085467447 11:76733959-76733981 CAGGGCCAGTCGTGGGGTGGGGG - Intergenic
1086161896 11:83731290-83731312 CAGGGCCAGTCAGGGGCTGGGGG - Intronic
1086197172 11:84154651-84154673 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1086234860 11:84617137-84617159 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
1086277451 11:85147906-85147928 CAGGGCCAGTCAGGGGGTGGGGG - Intronic
1087002892 11:93439249-93439271 CAGGGCCTGTCGAGGGATGGGGG - Intergenic
1087192849 11:95273983-95274005 CAGGGCCTGTCGTGGGGTGGAGG + Intergenic
1087391706 11:97543033-97543055 CAGGGCCTGTTGGGGGATGGAGG + Intergenic
1087423514 11:97963297-97963319 CGGGGCCTGTCGAGGGGTGGGGG - Intergenic
1087521792 11:99247614-99247636 CAGGGCCTGTTGTGGGATGGGGG - Intronic
1087564452 11:99836295-99836317 CAGGGCCTGTCGGGGGTTGGGGG - Intronic
1087794879 11:102445007-102445029 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1087846622 11:102980810-102980832 CAGGGCCTGGTTGGGGATGGGGG + Intergenic
1087869315 11:103272411-103272433 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1087916252 11:103814964-103814986 CAGGGCCTGTCGTGGGGTGGAGG - Intergenic
1088001311 11:104884966-104884988 CAGGGCCTGTCCAGGGGTGGGGG + Intergenic
1088067007 11:105731865-105731887 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1088077098 11:105863613-105863635 CAGGGGCAGGAGTGGGAGGGAGG - Intronic
1088310310 11:108452988-108453010 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1088397308 11:109382782-109382804 CAGGGCCAGGTGGAGGATGCGGG + Intergenic
1088523403 11:110724967-110724989 CAGGGCCTGTCGGGGGTTGGGGG - Intergenic
1088525257 11:110746149-110746171 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088692578 11:112340426-112340448 TAGGGCCAGGCCAGGCTTGGTGG + Intergenic
1088899212 11:114102544-114102566 CAGGGGCAGCCGGGGGGTGGGGG - Intronic
1089043299 11:115474686-115474708 CAGGGCCAGTCGTGGGGTGGGGG + Intronic
1089604825 11:119635752-119635774 CAGAGCCCGGGGAGGGAAGGCGG + Intronic
1089692918 11:120197880-120197902 CAGGGCAAGGCGGTGGGTGGGGG + Intergenic
1089769719 11:120794278-120794300 GAGAGCCAGGCGATGGTTGGAGG + Intronic
1089774062 11:120823891-120823913 CAGGGCCAGAGCAGGGAAGGTGG + Intronic
1089977226 11:122742987-122743009 CAGGGCCAGGTGGGCCATGGAGG - Intronic
1090042693 11:123304540-123304562 GAGGGCAAGATGAGGGATGGAGG + Intergenic
1090215766 11:124962802-124962824 CAGGGCCTGTCGTGGCATGGTGG - Intronic
1090645682 11:128765044-128765066 CAGGGCCGGGGGAGGGAGAGAGG + Intronic
1091097477 11:132837772-132837794 CAGGGCATGGCGGGGGAAGGCGG + Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091857696 12:3752822-3752844 AAGGGCCAGGCCAGGCCTGGGGG + Intronic
1091867823 12:3857115-3857137 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1091925715 12:4346593-4346615 CAGGGCCTGTTGTGGGATGGGGG + Intronic
1092454593 12:8631840-8631862 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1092948289 12:13476543-13476565 CAGGGCCATGAAAGGGCTGGTGG + Intergenic
1093016546 12:14161149-14161171 GAGGGTCAGGAGAGGGAGGGGGG + Intergenic
1093081555 12:14817483-14817505 CAGGGCCAGTTGAGGAGTGGGGG - Intronic
1093218569 12:16391319-16391341 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1093357713 12:18189068-18189090 CAGGGCCAGTCATGGGGTGGAGG + Intronic
1093502859 12:19832298-19832320 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
1093875697 12:24346866-24346888 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1093905270 12:24684025-24684047 CAGGGCCTGTTGAGGGCTGGCGG - Intergenic
1094083409 12:26562754-26562776 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1094234823 12:28151700-28151722 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1094289902 12:28835963-28835985 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1094523746 12:31218646-31218668 CAAGGCAGGGCGGGGGATGGGGG - Intergenic
1094789804 12:33898943-33898965 CAGGGCCTGTCGGGGGTTGGGGG + Intergenic
1095234746 12:39783023-39783045 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1095613791 12:44164354-44164376 CAGGGGAAGGGGTGGGATGGTGG - Intronic
1095793258 12:46190090-46190112 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1095804789 12:46307194-46307216 CAGGGCCTGTTGTGGGATGGGGG - Intergenic
1096043926 12:48545252-48545274 GAGGGCTAGGCCAGGCATGGTGG + Intergenic
1096071148 12:48776184-48776206 CAGGGCCAGGGCAGGGCTGGGGG - Intronic
1096609744 12:52793317-52793339 GAGGGGCAGGATAGGGATGGAGG - Intronic
1096625202 12:52890879-52890901 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1096677223 12:53232298-53232320 CAGGGGCAGGCAGGGGAGGGAGG - Intronic
1097078530 12:56412681-56412703 CAGGGCCGGGCGGGGGGGGGCGG + Intergenic
1097310952 12:58118407-58118429 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1097333383 12:58356124-58356146 AAGTGCCAGGCCAGGCATGGTGG - Intergenic
1097356220 12:58605047-58605069 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1097401973 12:59139027-59139049 CAGGGCCTGTCGGGGGCTGGAGG - Intergenic
1097407000 12:59201205-59201227 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1097624394 12:61982277-61982299 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1097719187 12:63002045-63002067 CAGGGCCTGTCGAGGGGTGAGGG - Intergenic
1098136607 12:67409508-67409530 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1098306723 12:69109768-69109790 CAAGGCCAGGCCAGGCATGGTGG - Intergenic
1098717388 12:73847692-73847714 CAGGGCCTGTTGGGGGATGGAGG + Intergenic
1099052912 12:77803280-77803302 CAGGGCCTGTTGGGGGATGGGGG - Intergenic
1099207463 12:79744644-79744666 CAGGGCTAGGCCAGGCATGGTGG - Intergenic
1099626901 12:85087095-85087117 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1099653257 12:85456618-85456640 CAGTGGCAGGCCAGAGATGGTGG + Intergenic
1100248951 12:92794719-92794741 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1101048514 12:100836494-100836516 CAGGGCCTGTTGTGGGATGGGGG - Intronic
1101291637 12:103376394-103376416 CAGGGCCTGTCGAGGGGTGGGGG + Intronic
1101850259 12:108396246-108396268 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1102145814 12:110654441-110654463 AAGGGCATGGCGGGGGATGGGGG + Intronic
1102439759 12:112953140-112953162 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1102567201 12:113804539-113804561 CAGGCCCTGGCCAGGCATGGTGG - Intergenic
1103043975 12:117719960-117719982 AAGGGCCAGGAGTGGGATGCTGG - Intronic
1103566826 12:121820254-121820276 CTGGGCCAGGTGAGGGCTGCAGG + Intronic
1103629919 12:122251762-122251784 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1103700806 12:122847904-122847926 CAAGGCCAGTGGAGCGATGGGGG - Intronic
1103743029 12:123104216-123104238 TAGAGCCAGGCCAGGCATGGTGG - Intronic
1103940941 12:124500824-124500846 GAGGGGCAGGCGGGGGCTGGTGG + Intronic
1104090704 12:125514743-125514765 CAGGACCAGGGAAGGGAGGGAGG - Intronic
1104488584 12:129174231-129174253 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
1104534311 12:129604154-129604176 CAGGGCCCGTCGAGGGGTTGGGG + Intronic
1104588509 12:130066267-130066289 CAGGGACAGGATAAGGATGGGGG + Intergenic
1104990349 12:132620913-132620935 CAGTCCCAGGCCAGGGAAGGGGG - Intronic
1105445434 13:20451048-20451070 CCGGGCCTGTCGAGGGGTGGGGG + Intronic
1105518821 13:21113681-21113703 CAGGGCAAGGCCGGGCATGGTGG - Intergenic
1106030965 13:26002403-26002425 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1106110987 13:26776772-26776794 CAGGGCCTGTCGAAGGGTGGGGG - Intergenic
1106204794 13:27582729-27582751 CAGGGCCTGTCAGGGGATGGGGG + Intronic
1106268057 13:28127511-28127533 CAGTTCCAGGCCAGGCATGGTGG - Intergenic
1106597713 13:31161305-31161327 CCCGGCCAGAGGAGGGATGGGGG - Intronic
1106647442 13:31651505-31651527 CAGGGCCATGTGAGGGAAGAGGG - Intergenic
1106757548 13:32838063-32838085 CAAGGCCAGGTGAGCTATGGAGG + Intergenic
1107015548 13:35705706-35705728 CTGGGCCAGGCCGGGCATGGTGG + Intergenic
1107036267 13:35905656-35905678 CAGAGCCAGGCCAGGTGTGGTGG + Intronic
1107153563 13:37140473-37140495 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1107363493 13:39645070-39645092 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1107973055 13:45662913-45662935 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1108047264 13:46395116-46395138 CAGGGCCTGTCAAGGGGTGGGGG + Intronic
1108121960 13:47197784-47197806 GAGGGTCAGGCGCAGGATGGAGG - Intergenic
1108165235 13:47686336-47686358 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1108177245 13:47805210-47805232 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1108351934 13:49595850-49595872 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1108734359 13:53267213-53267235 CAGGGCCTGTCGCGGGGTGGGGG - Intergenic
1109011698 13:56957263-56957285 CAGGGCCTGTCGTGGTATGGAGG - Intergenic
1109188469 13:59297674-59297696 CGGGGCCTGTCGAGGGCTGGGGG + Intergenic
1109282793 13:60376438-60376460 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1109363799 13:61329563-61329585 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1109432106 13:62249595-62249617 CAGGGCCTGTCGGGGGTTGGGGG + Intergenic
1110009352 13:70312349-70312371 CAGAGTCTGGGGAGGGATGGGGG + Intergenic
1110138275 13:72096308-72096330 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1110504611 13:76271208-76271230 CAGGGCCTGTCTGGGGATGGAGG - Intergenic
1110631572 13:77714010-77714032 CAGGGCCTGTCGAGGGGTGGGGG + Intronic
1110642469 13:77841438-77841460 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1110813498 13:79836814-79836836 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1110828214 13:79997925-79997947 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1110861657 13:80350842-80350864 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
1111364544 13:87224708-87224730 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
1111712617 13:91835722-91835744 CAGGGCCTGTCGGGGGTTGGGGG + Intronic
1111905516 13:94251289-94251311 CAGGGCCAGGCAGGGGGTGGGGG + Intronic
1111916180 13:94363043-94363065 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1112076013 13:95914085-95914107 CAGGGCCTGTTGAGGGATGGGGG + Intronic
1112270590 13:97965178-97965200 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1112499603 13:99932365-99932387 CAGGGTCAGGCCAGGCACGGTGG - Intergenic
1112585626 13:100716277-100716299 AAGGGCCAGGTGAGGGTGGGAGG - Intergenic
1112723471 13:102274145-102274167 CAGGCACAGGCAAGGGATAGTGG - Intronic
1113143725 13:107183831-107183853 CAGGGCCTGTCGAGGGGAGGAGG + Intronic
1113241907 13:108347547-108347569 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
1113268752 13:108649062-108649084 CAGGGCCTGTTGTGGGATGGGGG + Intronic
1113331663 13:109333342-109333364 CAGGGCCCAGCGTGGGAAGGCGG + Intergenic
1113409831 13:110075262-110075284 CAGGGCCTGGTGAGTGTTGGGGG - Intergenic
1113681454 13:112247780-112247802 CTGACCCAGGCGAGGGTTGGGGG - Intergenic
1114715160 14:24816813-24816835 CAGGGACAGGGAAGGAATGGAGG - Intronic
1114785317 14:25590673-25590695 CAGGGCTTGTCGAGGGGTGGGGG - Intergenic
1115340435 14:32287926-32287948 CCGGGCCAGTCGGGGGAAGGGGG - Intergenic
1115581207 14:34760560-34760582 TAGGGCCAGGCCAGGTGTGGTGG + Intronic
1115626186 14:35194521-35194543 CAGGGCCTGTCGGGGGATGAGGG + Intronic
1115673468 14:35643170-35643192 CAGGGCCTTTCGAGGGGTGGGGG + Intronic
1115753561 14:36513637-36513659 CAAGGCCAGGAGGGGGGTGGGGG - Exonic
1116152601 14:41160102-41160124 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1116432249 14:44859402-44859424 CAGGGCCTGTCGTGGGATGGGGG + Intergenic
1116673118 14:47869486-47869508 CGGGGCCTGTCGTGGGATGGAGG - Intergenic
1116978049 14:51137772-51137794 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1117197593 14:53355954-53355976 CAGGCCCAGGCAAGGGCTGTGGG - Intergenic
1117600631 14:57370541-57370563 CAGGGCCTGTCGGGGGCTGGTGG + Intergenic
1117613931 14:57513638-57513660 CAGGGCCAGTCGGGAGGTGGGGG - Intergenic
1117895832 14:60485771-60485793 GAGGGCGCGGCGGGGGATGGGGG - Intronic
1117999112 14:61506423-61506445 CCTGGCCAGTCCAGGGATGGGGG + Intronic
1118086472 14:62423670-62423692 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1118092177 14:62494510-62494532 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
1118310089 14:64685741-64685763 CAGGCCTAGGGAAGGGATGGTGG - Intergenic
1118545245 14:66879195-66879217 CAGGGCCTGTCAGGGGATGGAGG + Intronic
1118829407 14:69416072-69416094 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1118887675 14:69879982-69880004 CGGGGACAGGGGAGGGATGGTGG - Intronic
1119006552 14:70936283-70936305 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1119828353 14:77677325-77677347 TATGGCCAGGCCAGGCATGGTGG - Intronic
1120595268 14:86426649-86426671 CAGGGCCTGTCAAGGGGTGGAGG - Intergenic
1120627099 14:86841589-86841611 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1120641278 14:87016169-87016191 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1121055096 14:90845711-90845733 CAGGGACAGGCGAGAGTTGGGGG - Intergenic
1121123754 14:91392898-91392920 CAGGGCCAGGGGTGTGATGACGG + Intronic
1121157466 14:91700086-91700108 CCGGGCCTGTCGAGGGGTGGGGG - Intronic
1121258421 14:92549008-92549030 CAGGGGCCGGCGTGGGAGGGAGG - Intronic
1121798756 14:96756133-96756155 CAGGGCCAGGGAGGGGATGGAGG - Intergenic
1121904749 14:97729396-97729418 CAGGGCCTGTCGTGGGGTGGAGG - Intergenic
1122070281 14:99201560-99201582 CAGGGCCAGGACAGGGACTGGGG - Intronic
1122113880 14:99518250-99518272 CAGGTCCAGGCCAGGGCGGGCGG - Intronic
1122442815 14:101744387-101744409 CAGGGCCTGTCGTGGGGTGGAGG - Intergenic
1122467143 14:101941582-101941604 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
1122482457 14:102055825-102055847 CAGGGCCAGGCGGGGAAGTGGGG - Intergenic
1122707460 14:103629820-103629842 CAGGGCCAAGCCGGGGATGCGGG - Intronic
1122796936 14:104210717-104210739 CAGGGCTGGGGGAGGGATTGAGG + Intergenic
1122917278 14:104865059-104865081 CTGGGGCAGGGGCGGGATGGCGG + Intergenic
1122969062 14:105145112-105145134 CAGCGCCAGTCCAGGGATGTAGG - Intronic
1122971447 14:105153881-105153903 CTGGGCCAGGCGAGGGTGAGTGG + Intronic
1122986390 14:105213627-105213649 CAGTGCCAGGTGGGGGAGGGAGG - Intronic
1123068275 14:105628900-105628922 CAGGGACAGGGGAGGGACAGGGG - Intergenic
1202918546 14_KI270723v1_random:7986-8008 GAAGGCCTGGGGAGGGATGGTGG + Intergenic
1202926076 14_KI270724v1_random:26585-26607 GAAGGCCTGGGGAGGGATGGTGG - Intergenic
1123779710 15:23614306-23614328 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1124084748 15:26537443-26537465 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1124163063 15:27292267-27292289 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1124187778 15:27544927-27544949 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1124232135 15:27954858-27954880 CAGGGCCAGGAGCGGGCTGGTGG + Intronic
1124336202 15:28858910-28858932 CAGGTCCAGGCCGGGCATGGTGG - Intergenic
1125224370 15:37378675-37378697 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1125837917 15:42770090-42770112 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1125889907 15:43258066-43258088 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1125977498 15:43967920-43967942 CAGGGCCTGTCGAGGGGTTGGGG - Intronic
1125984508 15:44037140-44037162 CAGGGCCTGTCGGGGGTTGGGGG - Intronic
1126462459 15:48928069-48928091 TAGGGCGAGCCGAGGGACGGAGG + Intronic
1126569309 15:50132948-50132970 CAGGGCCTGTTGAGGGGTGGTGG + Intronic
1126665940 15:51076733-51076755 CAGGGGCAGGGCAGGGCTGGAGG - Intronic
1126706262 15:51408684-51408706 CAGGGCCTGTCATGGGATGGTGG - Intergenic
1126772494 15:52072017-52072039 CAGAACCAGGCCAGGGGTGGGGG + Intergenic
1126967599 15:54073034-54073056 CAGGGCCTGTCGGGGGGTGGAGG - Intronic
1126995345 15:54436651-54436673 CAGGGCCTGTCGAGGGTTGGGGG + Intronic
1127021651 15:54755246-54755268 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1127038794 15:54950044-54950066 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1127182203 15:56433245-56433267 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1127445154 15:59054222-59054244 AAGGGCCAGGCCAGGCGTGGTGG - Intronic
1127931630 15:63600927-63600949 CAGGGCCAGGCGCGGGCACGCGG - Intronic
1127970218 15:63952939-63952961 AGGGGCCAGGCCAGGGGTGGGGG - Intronic
1128529452 15:68433741-68433763 CAGGGTCAGGGTAGGGAAGGAGG + Intergenic
1128594518 15:68931239-68931261 CAGGGCCTGCCGTGGGGTGGGGG - Intronic
1128669556 15:69564389-69564411 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1128682588 15:69662575-69662597 CAAGGCCAGCCCAGGGCTGGTGG - Intergenic
1128770550 15:70278542-70278564 CGGGGCCAGGATGGGGATGGGGG + Intergenic
1129117772 15:73374840-73374862 CAGAGCCAGGCCAGAGAGGGAGG + Intergenic
1129120994 15:73396561-73396583 CAGGACGAGGCCAGGCATGGTGG - Intergenic
1129242925 15:74262168-74262190 CAGGGCAGGGGTAGGGATGGGGG - Intronic
1129385259 15:75192764-75192786 CAGGACCAGGAGAGATATGGAGG - Intergenic
1130080972 15:80733180-80733202 CGGGGACAGGGGAGGGAAGGTGG - Intronic
1130848849 15:87773865-87773887 CAGGGCCAGTCAAGGGCTAGGGG + Intergenic
1130957727 15:88639175-88639197 CAGGGTAAGGCAGGGGATGGGGG + Intronic
1131131696 15:89904563-89904585 CAGGGCCAGGAGAGAGGAGGGGG - Intronic
1131135702 15:89933518-89933540 CAGGGGCAGGAGTGGGAGGGAGG + Intergenic
1131431976 15:92394780-92394802 CAAAGCCAGGCGAGGGCGGGGGG - Intronic
1131510098 15:93045016-93045038 CAGGGCCAGGAGCGGGACGAGGG + Exonic
1131524764 15:93143936-93143958 CAGTGACAGGCCAGGCATGGCGG - Intergenic
1131774215 15:95776144-95776166 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1131829813 15:96347041-96347063 CACTGCCAGGCAAGGGAAGGGGG - Intergenic
1131838903 15:96416259-96416281 CAGGGCCAGGCGGGGCCTGTTGG - Intergenic
1132145585 15:99427404-99427426 CAGTGCAAGGCGAGGGCTTGTGG - Intergenic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1132244012 15:100280565-100280587 CAGGGCCTGGTGAGGGAGGGCGG - Intronic
1132327554 15:100984491-100984513 AGGGGCCAGGGGAGGGAGGGAGG - Intronic
1132349990 15:101133542-101133564 CAGGGCCAGGCCAGCCATGGGGG + Intergenic
1132518696 16:377624-377646 CTTGGCCAGGCGCGGGAGGGTGG + Intronic
1132574452 16:658103-658125 CAGGGTCAGGCTCGGGAGGGAGG - Intronic
1132576267 16:665817-665839 CCGGGCCGGGGGCGGGATGGGGG + Intronic
1132611276 16:817455-817477 GAGGGCCTGGCGGGCGATGGTGG - Intergenic
1132722878 16:1325664-1325686 CAGGTCCAGACCAGGGCTGGGGG + Exonic
1132760721 16:1507388-1507410 CTGGGCCAGGCCAGGGGTGCAGG + Intronic
1132940059 16:2502016-2502038 CAGGGCCAGGGGAGGGCACGGGG - Exonic
1133795927 16:9046116-9046138 CAGGGTCAGGCTGGGCATGGTGG - Intergenic
1133828110 16:9297147-9297169 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1134231723 16:12435073-12435095 CAGGCCCAGGAGAGGGTTGGAGG + Intronic
1134254498 16:12600444-12600466 CAGGGACAGGCCAGGGAAGTGGG - Intergenic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1135559124 16:23461697-23461719 TAGGGTCAGGCTAGGCATGGTGG + Intergenic
1136410346 16:30073081-30073103 GAGGTCCAGGCCAGGCATGGTGG - Intergenic
1136622904 16:31442208-31442230 CCGCGCCAGGCGAGGCTTGGTGG - Intronic
1137026952 16:35486303-35486325 CAGGGCCAGGGTAGGGGAGGAGG - Intergenic
1137027315 16:35489982-35490004 GAGGGCCTGGGGAAGGATGGTGG + Intergenic
1137337941 16:47569908-47569930 AAGGGCTAGGCCAGGCATGGTGG - Intronic
1137655986 16:50158372-50158394 AAAGGCCAGGCCAGGCATGGTGG - Intronic
1137914576 16:52415137-52415159 CAGGGCCAGTCGGGGGATGGGGG - Intergenic
1138102108 16:54260700-54260722 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1138169942 16:54839454-54839476 TAAGGCCAGGCCAGGCATGGTGG + Intergenic
1138202159 16:55097415-55097437 CAGGGCCTGTTGAGGGGTGGAGG - Intergenic
1138595672 16:58027767-58027789 CCTGGCCAGGCCAGGGAGGGAGG - Intronic
1138598508 16:58041878-58041900 CAGGGCCAGGCATGGGAGGCGGG - Intronic
1138855606 16:60687541-60687563 CGGGGCCTGTCGTGGGATGGGGG + Intergenic
1138900326 16:61261297-61261319 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1138986361 16:62333575-62333597 CGGGGCCTGTCGTGGGATGGGGG + Intergenic
1139072783 16:63403710-63403732 CAGGGCCAGACGAGGGGAGGCGG + Intergenic
1139464374 16:67146403-67146425 CAGGGCCAGGTGAATGATGGAGG + Intronic
1139475507 16:67200691-67200713 AAGGGCCAGGGGAGGCACGGAGG - Exonic
1140225069 16:73070609-73070631 CAGTGCCTGCCGAGGGAGGGCGG - Intergenic
1140309280 16:73833592-73833614 CAGGGCCTGTCGGGGGTTGGGGG + Intergenic
1140521870 16:75588694-75588716 CAGAGCCCGGCCAGGCATGGTGG - Intergenic
1140691359 16:77487544-77487566 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1140730158 16:77849028-77849050 CAGGGCCTGTCAAGGGGTGGCGG + Intronic
1140742314 16:77952461-77952483 CAGATGCAGGCGAGGGGTGGTGG - Intronic
1141340105 16:83195489-83195511 CAGGACCAAGAGAGAGATGGGGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1142010139 16:87709736-87709758 CAAGGCCAGGCAAGGGTTTGCGG + Intronic
1142095819 16:88238910-88238932 CAAGGCCATGGGAGGGAGGGAGG - Intergenic
1142215515 16:88827858-88827880 CAGGGCCTGGCAGCGGATGGCGG - Intronic
1142265542 16:89062572-89062594 CAGGGGCAGGGGAGGGAGTGAGG + Intergenic
1142284794 16:89167335-89167357 CAGGGCCAGGGAAAGGGTGGTGG + Intergenic
1142468355 17:148346-148368 TAGGGACAGAGGAGGGATGGGGG + Intronic
1142709437 17:1715435-1715457 CAGGGCCAGGCCTGGGCTAGGGG + Intergenic
1142799855 17:2338014-2338036 CAAGGCCGGGGGAGGGGTGGCGG + Intronic
1142932736 17:3300844-3300866 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
1143036170 17:4000252-4000274 CTGGGCAAGGCCAGGCATGGTGG - Intergenic
1143100419 17:4501528-4501550 CCAGGCCAGGAGAGGGAGGGAGG - Intronic
1143312577 17:6004352-6004374 CAGGGCCTGTTGTGGGATGGGGG + Intronic
1143367771 17:6419651-6419673 CAGGGCCTGTCAGGGGATGGGGG + Intronic
1143387929 17:6543183-6543205 CGGGGCCAGGAGAGGGAGTGGGG - Intronic
1143413284 17:6725695-6725717 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1143510654 17:7393672-7393694 CGGGGCCAGGCGAGGGGAAGAGG + Exonic
1143520167 17:7440225-7440247 CCGGGGCAGGCGGGGGCTGGGGG - Intronic
1143849213 17:9797103-9797125 CAGGGCCAGTCGCAGGGTGGAGG - Intronic
1144076063 17:11720401-11720423 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1144208233 17:12994134-12994156 CAGGGGAAGGCGGGGGCTGGGGG - Intronic
1144338340 17:14292700-14292722 CAGGGCCTGCTGGGGGATGGGGG - Intergenic
1144397324 17:14857338-14857360 CAGGGCCAGTCAGGGGGTGGGGG - Intergenic
1144500890 17:15786315-15786337 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1144563310 17:16339648-16339670 GATGGCCAGGCCAGGCATGGTGG - Intronic
1144742898 17:17594023-17594045 CTGGGCCAGGCTGGGCATGGTGG + Intergenic
1145128627 17:20321663-20321685 AATGGCCAGGCGAAGGATGCGGG + Intergenic
1145163052 17:20588977-20588999 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1145855783 17:28155768-28155790 CAGGGCCTGTCGGGGGGTGGAGG + Intronic
1145910684 17:28540385-28540407 CAGGGCCAGGCTGGGGCAGGTGG - Intronic
1145955418 17:28851243-28851265 CTGGGCCAAGCCAGGCATGGTGG + Intronic
1145976262 17:28986063-28986085 CGGGGCCATGCCAGGGCTGGGGG - Intronic
1146008928 17:29179373-29179395 CAGGGACAGGCCAGGCATTGGGG - Intronic
1146438788 17:32876441-32876463 CCGCGCCAGGTGAGGGATGTGGG - Intronic
1146590817 17:34126706-34126728 CAGGCACAGGCAGGGGATGGAGG + Intronic
1146686160 17:34842915-34842937 TGGGGCTAGGAGAGGGATGGAGG - Intergenic
1146874682 17:36399160-36399182 CAGGGCCTGTCAGGGGATGGCGG - Intronic
1147064701 17:37913721-37913743 CAGGGCCTGTCAGGGGATGGCGG + Intergenic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1147379242 17:40043445-40043467 CAGGGACAGTCCAGGGGTGGTGG + Intronic
1147387981 17:40092837-40092859 GAGGGCCAGGGGAGGGTTGTGGG + Exonic
1147522953 17:41191976-41191998 CAGGGCCTGTCGGGGGATGGGGG + Intronic
1147554750 17:41470151-41470173 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
1147580685 17:41625636-41625658 CAGGGCCGGGCTTGGGGTGGTGG - Intergenic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1147599787 17:41738677-41738699 CAGGGTCAGGCCAGGGGAGGGGG - Intergenic
1147901943 17:43792648-43792670 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1148777098 17:50101950-50101972 CAGGTCCTGGGGAGGGGTGGGGG + Intronic
1149064184 17:52460573-52460595 CGGGGCCTGGCGTGGGGTGGGGG + Intergenic
1149196296 17:54125931-54125953 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1149315912 17:55438522-55438544 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1150017620 17:61574026-61574048 CAGGCCCAGGATAGGAATGGAGG - Intergenic
1150195893 17:63298924-63298946 CAGGGCCAGTCGGGGGATGTGGG - Intronic
1150271876 17:63872072-63872094 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1150275425 17:63894972-63894994 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1150277556 17:63909661-63909683 CAGGGCCAGGAGAGGCACTGGGG + Intronic
1150278848 17:63917258-63917280 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1150460144 17:65343791-65343813 CGGGGCCTGTCGGGGGATGGGGG + Intergenic
1150739944 17:67771399-67771421 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1151005955 17:70436152-70436174 CTGGGCCTGTCGGGGGATGGGGG - Intergenic
1151178187 17:72306247-72306269 ATGGGCCAGGGGAGAGATGGTGG - Intergenic
1151348368 17:73516952-73516974 CGGGGCCAGTCTAGGGAAGGAGG + Intronic
1151508076 17:74542337-74542359 CCTGGCCAGGCCAGGGAAGGGGG - Intronic
1151835646 17:76581203-76581225 AAGGGGCAAGGGAGGGATGGGGG - Intronic
1152006248 17:77683447-77683469 CAGGGCCAGGCCAGGCACAGTGG - Intergenic
1152345498 17:79748373-79748395 CAAGGCCCGGCGAGGGGCGGAGG - Intergenic
1152518255 17:80838685-80838707 CACGGGGAGGCCAGGGATGGGGG + Intronic
1152524438 17:80879442-80879464 CAGGTCCAGGCCCGGGATGTGGG - Intronic
1152525842 17:80887940-80887962 AAGGGCCAGGCCAGGGGTGCGGG + Intronic
1152784205 17:82239613-82239635 CAGGGGCAGGCGCTGCATGGAGG + Exonic
1152853066 17:82648761-82648783 CGGGGCGAGGCGAGGAAAGGCGG + Intergenic
1152966367 18:119102-119124 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1153056448 18:950467-950489 CAGGGCCTTGCGAGGGCTGGGGG + Intergenic
1153285137 18:3449921-3449943 CACCGCCGGGCGAGGGATGCGGG + Intronic
1153487029 18:5609455-5609477 CAGGGCCAGGCCTGGGAAGGAGG - Intronic
1154053773 18:10991383-10991405 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1154221145 18:12455223-12455245 CAGGGCCAGGCCAGGCATGGTGG - Intronic
1154927606 18:20952961-20952983 CAGGGCCTGTCGAGGGATGGGGG + Intronic
1154986410 18:21555563-21555585 CAGGTCTAGGCCAGGCATGGTGG + Intronic
1155175246 18:23296081-23296103 CAGGGCCTGTCAGGGGATGGAGG + Exonic
1156086773 18:33415539-33415561 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1156606143 18:38669353-38669375 CAAGGCCAGTTGTGGGATGGGGG + Intergenic
1156743655 18:40363531-40363553 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1156982062 18:43301050-43301072 TAGGGCCAGGCCAGGTATGGTGG - Intergenic
1157029754 18:43891182-43891204 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1157046479 18:44106687-44106709 CAGGGCCTGTCATGGGATGGGGG + Intergenic
1157222673 18:45838801-45838823 CCGGACCAGGCGAGGGCGGGCGG - Exonic
1157289514 18:46399792-46399814 CAGGGCCTGGTGAGGGGAGGAGG - Intronic
1157936366 18:51877164-51877186 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1157988498 18:52467199-52467221 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1158100549 18:53824877-53824899 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1158857520 18:61558086-61558108 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1158872216 18:61699182-61699204 CATGGCCAGACAAGGGGTGGTGG - Intergenic
1159463579 18:68750787-68750809 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1159635325 18:70798333-70798355 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1159705193 18:71677596-71677618 CAGGGCCTGTTGAGGGGTGGGGG - Intergenic
1159811472 18:73022603-73022625 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1160408589 18:78659777-78659799 CAGGGACAGCTGGGGGATGGTGG - Intergenic
1160414974 18:78703471-78703493 CAGGGCCTGGGGAGGGGTGAGGG - Intergenic
1160685933 19:436611-436633 CACGGTGAGGCCAGGGATGGGGG - Exonic
1160797990 19:954587-954609 TGGGGCCATGCGAGGGCTGGGGG + Intronic
1160821732 19:1062159-1062181 CCGGGCCACGCTGGGGATGGGGG - Exonic
1160875613 19:1295095-1295117 CAGTGCCAGGCAAGAGATCGTGG + Intronic
1160882907 19:1330424-1330446 CAGGGCCAGGCCAGGCGCGGTGG - Intergenic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160914659 19:1490896-1490918 CAGGGCGAGGAGAGGCGTGGGGG - Exonic
1160953342 19:1678024-1678046 CAGGGCCAGAGCAGGGATGGGGG + Intergenic
1161028809 19:2048662-2048684 CAAGGCCAGGAGATGGGTGGAGG + Intronic
1161068993 19:2251197-2251219 CAGGGCCAGGCGCGGCGCGGAGG - Exonic
1161243276 19:3234831-3234853 CTGGTCCAGGTGAGGGATGAGGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161398904 19:4059071-4059093 CAGGGCCAGACGGCAGATGGTGG - Intronic
1161451814 19:4350497-4350519 CTGGTCCAGGTGAGGGATGATGG + Intronic
1161457169 19:4375225-4375247 CTGGGCCAGGTGGGGGCTGGAGG - Intronic
1161582016 19:5086260-5086282 CAGGGCCCGGCCAGGGCAGGAGG - Intronic
1161623140 19:5309808-5309830 CAGATCCAGGCCAGGGATGATGG - Intronic
1161760513 19:6167900-6167922 CAGGTCCAGGGGAGCGATGATGG - Intronic
1161902737 19:7131709-7131731 CAGGATCAGGCCAGGCATGGTGG + Intronic
1162527046 19:11212155-11212177 CAGGGACAGGGGCGGGAGGGTGG + Intronic
1162531605 19:11239424-11239446 CAGGGCCAGGTGTGGGTGGGGGG - Intronic
1162559315 19:11406635-11406657 CTGGGCCAGGGGAGGGGTGTGGG + Intronic
1162750732 19:12827804-12827826 CAGGGCCTGGCTGGGCATGGTGG + Intronic
1162899749 19:13787720-13787742 CAGGTCGAGGCGGGGGAAGGTGG - Intergenic
1162972701 19:14190608-14190630 CAGGGGAAGGCGGGGGATGTAGG - Intronic
1162988798 19:14289109-14289131 CTGGACCAGGTGAGGGATGCTGG + Intergenic
1163053223 19:14700610-14700632 CAGGGCCAAAGGGGGGATGGTGG - Intronic
1163248264 19:16110770-16110792 CCGGGCCAGCCCGGGGATGGTGG - Intergenic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1163566050 19:18052004-18052026 CAGCTCCAGGCCAGGGAAGGTGG + Intergenic
1163681249 19:18683856-18683878 CAGGGCCGGCGGAGGGAGGGAGG + Intronic
1163728951 19:18938938-18938960 CAGGGCCAGGCTGGGGGAGGTGG + Intronic
1163764953 19:19158468-19158490 TAGGGCCAGGCCAGGCACGGTGG + Intronic
1164093596 19:21983839-21983861 CAGGGCCTGTCAAGGGGTGGGGG + Intronic
1164176281 19:22778001-22778023 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1164231894 19:23296762-23296784 CAGGGCTAGTCAGGGGATGGGGG - Intergenic
1164238706 19:23364029-23364051 CCAGGCCAGGCCAGGCATGGTGG + Intronic
1164279458 19:23756630-23756652 CAGGGCCAGTCGGGGGGTGGAGG + Intronic
1164309055 19:24030443-24030465 CAGGGCCTGGGGAGAGGTGGGGG + Intergenic
1164538978 19:29108087-29108109 CAGGGCCAGGGCATGGCTGGGGG - Intergenic
1164730398 19:30499868-30499890 CAGGGGCAAGGGAGGGATGGTGG + Intronic
1164754562 19:30680003-30680025 CCAGGCCAGGGGAGGGAGGGAGG + Intronic
1165066563 19:33232632-33232654 CAGGGCAAGGCCAGAGAAGGTGG - Intergenic
1165355211 19:35299969-35299991 CAGGGCCAGGCAGGGATTGGGGG + Intronic
1165474899 19:36024777-36024799 CAGGGCAAGGCGGGGTAAGGTGG + Intronic
1165886704 19:39084157-39084179 CAGGGCGTGGCGCGGGAAGGGGG - Intronic
1165948300 19:39458397-39458419 CAGGGCCAGACCGGGGCTGGTGG - Intronic
1166049172 19:40247939-40247961 CAGGGCCAGGGGAGGGACATGGG + Intronic
1166088732 19:40494151-40494173 GAGGGGCAGGTGTGGGATGGAGG + Intronic
1166144194 19:40823098-40823120 CAGGGACATGCAAGGGATGGAGG - Intronic
1166172407 19:41038990-41039012 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1166180683 19:41106007-41106029 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166740353 19:45110982-45111004 CAGGGCCAGGCTCGGGAAAGGGG - Intronic
1166781754 19:45346785-45346807 CAGGGCGAGGCGGGGGGTGCTGG + Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1166982340 19:46638798-46638820 GAGGGCCAGGCGGGAGATGAAGG + Intergenic
1167111727 19:47466386-47466408 CAAGGCCAGGGGAGCCATGGGGG + Exonic
1167113165 19:47473714-47473736 CAGGCCCAGGCGTGGGAAGTTGG - Intergenic
1167166674 19:47803657-47803679 CAGGGCCAGGGGAGGGCCTGGGG + Exonic
1167175163 19:47860107-47860129 CAGGGCCAGGGGAGGGCCTGGGG - Intergenic
1167322540 19:48805818-48805840 GACAGCCAGGGGAGGGATGGCGG - Intronic
1167322563 19:48805878-48805900 GACAGCCAGGGGAGGGATGGCGG - Intronic
1167322575 19:48805908-48805930 GACAGCCAGGGGAGGGATGGCGG - Intronic
1167322587 19:48805938-48805960 GACAGCCAGGGGAGGGATGGCGG - Intronic
1167322610 19:48805998-48806020 GACAGCCAGGGGAGGGATGGCGG - Intronic
1167551317 19:50162915-50162937 CGGGGCTGGGCGAGGGATGCCGG - Intronic
1167621397 19:50563021-50563043 CAGAGACAGGCCAGGCATGGTGG - Intronic
1168060613 19:53890024-53890046 CGGGGCCAGGCGAGGGGGCGGGG - Intronic
1168169836 19:54578281-54578303 CGGGGCCAGTCTAGGGGTGGGGG - Intronic
1168239356 19:55081521-55081543 CAGGGCCAGGCGACTGGAGGCGG + Intronic
1168277435 19:55285375-55285397 CAGGGCCAGGGAGGGGATGGAGG + Intronic
1168296310 19:55378731-55378753 CATGGCGAGGCAAGGGGTGGGGG + Intergenic
1168412718 19:56149638-56149660 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
925042121 2:740259-740281 CAGAGCCTGGCGAGTGAGGGCGG + Intergenic
925182499 2:1826351-1826373 CAGGTCCTGGGGAGGGCTGGGGG + Intronic
925281305 2:2687173-2687195 CAGGGCCTGCTGGGGGATGGAGG + Intergenic
925322202 2:2981672-2981694 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
925337413 2:3108343-3108365 CAGGGGCGGGTGAGGGATGCTGG - Intergenic
925519170 2:4722486-4722508 CAGGGCCTGTCGCGGGGTGGGGG - Intergenic
925669385 2:6294553-6294575 CTGAGCCAGGCTGGGGATGGAGG - Intergenic
925901579 2:8512974-8512996 CAGGGCAAGGGCAGGGAGGGTGG - Intergenic
926104756 2:10143158-10143180 CAGGCTCAGGCCAGGCATGGTGG - Intronic
926163105 2:10501873-10501895 CAGGCCCAGTGGAGGGAAGGAGG - Intergenic
926563160 2:14439701-14439723 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
926697040 2:15777987-15778009 AAGGGGCAGGAGAGAGATGGAGG - Intergenic
927336627 2:21932028-21932050 CAGGGCCTGTCGAGGGGTGGGGG + Intergenic
927567899 2:24129965-24129987 CAGGGCCAGTCGAGGGCTGGGGG - Intronic
927663293 2:25011155-25011177 CCAGGCCAGGCCAGGCATGGTGG + Intergenic
927680563 2:25136397-25136419 CAGGGCCAGGGGAGCACTGGAGG + Intronic
927783488 2:25956736-25956758 CAGGGCTAGGAGGAGGATGGGGG + Intronic
927844071 2:26462298-26462320 CTGGGCCAGGCTGGGGCTGGAGG + Intronic
927917716 2:26947504-26947526 CAGGGCCAGAGGTGGGTTGGGGG - Exonic
927975320 2:27334176-27334198 CAAGGCCTGGCTAGGCATGGTGG - Intronic
928093568 2:28391031-28391053 CAGGCCCAGGAGAGGGGTGTGGG - Intergenic
928197636 2:29226890-29226912 CAGGGCCAGGGGAGGCAGAGGGG - Intronic
928199955 2:29241471-29241493 TAGGGCCAGGAGGGAGATGGGGG + Intronic
928252770 2:29696372-29696394 CAGGGCCTGTCGAGGGGTGGGGG + Intronic
928263772 2:29791467-29791489 CAGGGCCTGTCGAGGGGTGGTGG + Intronic
928268051 2:29829153-29829175 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
928326364 2:30322726-30322748 AAGGGCCAGGGGATGGGTGGTGG - Intronic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
928717777 2:34082795-34082817 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
928795908 2:35018415-35018437 CAGGGCCTGTTGCGGGATGGGGG + Intergenic
928796071 2:35021226-35021248 CAGGGCCTGTCGGGGGTTGGGGG - Intergenic
929248450 2:39727719-39727741 CGGGGCCTGTCGAGGGGTGGGGG - Intergenic
929255568 2:39807850-39807872 CAGGGTCTGTCGGGGGATGGGGG - Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929896700 2:45967050-45967072 CAGGGCCAGGGGTGTGCTGGTGG + Intronic
929927248 2:46224234-46224256 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
930029343 2:47048888-47048910 CAGAGACAGGCCAGGCATGGAGG - Intronic
930458030 2:51631402-51631424 CAGGGCCTGTTGTGGGATGGGGG + Intergenic
930584262 2:53251131-53251153 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
930616596 2:53600415-53600437 CAGGACTAGGCCAGGCATGGTGG - Intronic
930803603 2:55468136-55468158 CAGGGCCTGGCGTGGGGTGGGGG + Intergenic
931031557 2:58180545-58180567 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
931059540 2:58511222-58511244 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
931107542 2:59072956-59072978 CAGGGCCTGTCGAGGGGTGGGGG + Intergenic
931563913 2:63593379-63593401 AAGTGTCAGGCCAGGGATGGTGG - Intronic
931790189 2:65658042-65658064 CAGGGTCAGGCAGGGGCTGGAGG + Intergenic
931859417 2:66338824-66338846 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
932014592 2:68011569-68011591 GATGGTCAGGCGAGGTATGGGGG + Intergenic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932469342 2:71943764-71943786 AGGGGCCAGGCGAGTGAAGGTGG - Intergenic
932567146 2:72917431-72917453 CGGGGCGGGGCGAGGGACGGCGG - Intronic
932597739 2:73104663-73104685 CTGGGCCAGGAGAGGGAGTGAGG - Intronic
932715009 2:74094420-74094442 GAGGGCCAGGGGAGGGTTGCGGG + Intronic
933035706 2:77394826-77394848 CAGAACCAGGCCAGGGTTGGTGG + Intronic
934048038 2:88188031-88188053 CAGGGCCTGGGGAAGGATGGAGG - Intergenic
934113326 2:88762739-88762761 CTGGGCCTGTCGGGGGATGGGGG - Intergenic
934305017 2:91814507-91814529 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
934328240 2:92038241-92038263 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
934466620 2:94268782-94268804 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
934675441 2:96246576-96246598 CATGGAAAGGCGAGGGCTGGGGG + Intergenic
934677929 2:96262964-96262986 TCGGGCCAGGCCAGGCATGGAGG - Intronic
934895409 2:98115282-98115304 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
934948638 2:98560776-98560798 TAGGGCCAAGAGAGGGCTGGTGG + Intronic
935094699 2:99933491-99933513 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
935193265 2:100795013-100795035 CAGGGCCAGGAGACAGAGGGGGG - Intergenic
935399139 2:102641886-102641908 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
935667928 2:105529248-105529270 CAGGGCCTGCTGGGGGATGGGGG - Intergenic
936121081 2:109745719-109745741 CATAGCCCGGCGGGGGATGGTGG + Intergenic
936176433 2:110226297-110226319 CAGGGCCTGTCGAGGGGTGGAGG - Intergenic
936223614 2:110625752-110625774 CATAGCCCGGCGGGGGATGGTGG - Intergenic
936667532 2:114613956-114613978 CAGGGCCTGTCGGGGGTTGGGGG + Intronic
936985644 2:118309502-118309524 GAGAGGCAGGCGAGGGAGGGAGG + Intergenic
937076993 2:119114261-119114283 CAAGTCCAGGAGAGGGATGGTGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937134624 2:119542209-119542231 CTAGGCCAGGCCAGGCATGGTGG - Intergenic
937184007 2:120022336-120022358 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
937339602 2:121082655-121082677 AGGGGCCAGGCTAGGGCTGGGGG + Intergenic
937434386 2:121868088-121868110 CAGTGCCTGGGAAGGGATGGAGG - Intergenic
938020479 2:127902101-127902123 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
938810427 2:134847612-134847634 CATGGCCTGTCGGGGGATGGGGG - Intronic
938976672 2:136485199-136485221 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
939029522 2:137054934-137054956 CAGGGCCTGTCGTGGTATGGGGG - Intronic
939143019 2:138378008-138378030 CAGGGCCTGTTGAGGGGTGGGGG - Intergenic
939363392 2:141202881-141202903 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
939400344 2:141684442-141684464 CAGGGCCTGCCGGGGGGTGGGGG + Intronic
939973431 2:148688400-148688422 CAGGGCCTGTTGTGGGATGGGGG + Intronic
940796348 2:158083543-158083565 CAGGGCCCGTTGGGGGATGGGGG + Intronic
940839230 2:158559854-158559876 AAGGGCCAGTACAGGGATGGTGG - Intronic
940851454 2:158691286-158691308 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
941182077 2:162271445-162271467 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
941763513 2:169270594-169270616 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
942448219 2:176092505-176092527 AAGGGGCAGGAGAGGGGTGGGGG + Intergenic
942576382 2:177368045-177368067 CAGGGCCTGTCAGGGGATGGGGG - Intronic
942622326 2:177859084-177859106 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
942733155 2:179081340-179081362 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
942908799 2:181216290-181216312 TAGGGCCAAGCCAGGCATGGTGG - Intergenic
943545574 2:189272499-189272521 CAGGGCCTGTCGAGGGGTGGAGG + Intergenic
943709907 2:191080994-191081016 CAGGGCCTGTCAGGGGATGGGGG - Intronic
943764350 2:191644628-191644650 CAGGGCCTGTCGAGGGTTGCGGG - Intergenic
944185692 2:196945597-196945619 CAGGGCCTGTAGTGGGATGGGGG - Intergenic
944192743 2:197020951-197020973 CTGGGCCTGTCGTGGGATGGGGG - Intronic
944286444 2:197955541-197955563 CAGGGCCTGATGGGGGATGGGGG - Intronic
944439848 2:199731181-199731203 CAGGGCCTGTCGAGGGGTTGGGG + Intergenic
944601267 2:201305922-201305944 CAGGGCCAGTTGTGGGGTGGGGG + Intronic
944627382 2:201585222-201585244 CAGGGCCTGTCGAGGGGTGGGGG + Intronic
944845548 2:203664492-203664514 CAGGGCCTGCTGGGGGATGGGGG - Intergenic
945849758 2:214991871-214991893 CAGGGCCTGTCGGGGGATGGAGG + Intronic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946122066 2:217524613-217524635 CAGGGCCTGTCGGGGGTTGGGGG + Intronic
946153798 2:217793891-217793913 CAGGGCCAGACCTGGGAAGGGGG + Intergenic
946154914 2:217801010-217801032 ACTGGCCAGGAGAGGGATGGTGG - Exonic
946155920 2:217806533-217806555 CAGGGCCCTGCGAGGGAAGAAGG - Intronic
946960125 2:224976222-224976244 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
947211762 2:227715105-227715127 CAGGGCAAGGCCAGGCACGGCGG - Intronic
947238081 2:227964885-227964907 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
947786448 2:232825857-232825879 CAGGGTCTGTCGAGGGGTGGGGG - Intronic
947890280 2:233612206-233612228 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
947977406 2:234378952-234378974 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
948205201 2:236159778-236159800 CAGGGCCGGGCCCGGGGTGGGGG - Intergenic
948214865 2:236221095-236221117 CAGGGCCCGGCAGAGGATGGTGG + Intronic
948404500 2:237706914-237706936 TGGGGCCAGGCTAGGCATGGTGG - Intronic
948627255 2:239276770-239276792 CAGAGCCAGGCGAGGCAAGACGG + Intronic
948691267 2:239706613-239706635 CAGAGACAGGCGTGGGAAGGGGG + Intergenic
948884339 2:240875380-240875402 TCGGGCCAGTCGAGGAATGGGGG - Intronic
948885863 2:240884273-240884295 CAGGGCCAGGCCAAGCAGGGTGG - Intergenic
948886900 2:240889127-240889149 CAGGGCCTGGGGCAGGATGGAGG - Intronic
948915441 2:241032472-241032494 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
948976299 2:241465772-241465794 GTGGGACAGGCGAGGGATGGAGG - Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
1168932956 20:1638773-1638795 CAGGGCCAGTCAAGGGGTGGGGG - Intronic
1169357406 20:4919331-4919353 CTGGGCCAGGCGAGTGGTGGAGG - Intronic
1169396501 20:5235914-5235936 CAGGGCCTGTCAAGGGGTGGGGG - Intergenic
1169749750 20:8979929-8979951 CAGGGCCTGTCGGGGGTTGGGGG - Intergenic
1169891493 20:10457963-10457985 CAGGCCCTGGCCAGGCATGGTGG - Intronic
1170494080 20:16907588-16907610 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
1170873712 20:20231725-20231747 CAGGGCAAGGCTAGGGCTGTGGG + Intronic
1171185570 20:23121869-23121891 CAGGGCCAGGCACAGGATGGTGG + Intergenic
1171242527 20:23583157-23583179 CAGGGCCAGTCAGGGGGTGGGGG - Intergenic
1171242869 20:23585932-23585954 CAGGGCAGGACGAGGGAGGGAGG - Intergenic
1171480786 20:25454367-25454389 CAGGGCCAGGGCAGGTATGCAGG + Intronic
1172040249 20:32039758-32039780 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1172049951 20:32109820-32109842 CAGGGCCAGGCATGGGGTGCTGG - Intronic
1172088383 20:32407739-32407761 CCAGGCCAGGCCAGGCATGGTGG - Intronic
1172183474 20:33017499-33017521 AAGGGCGAGGCCAGGGGTGGTGG - Intronic
1172208371 20:33180722-33180744 CAGGGCCTAGCCTGGGATGGGGG - Intronic
1172223465 20:33289091-33289113 CAGAGCAAGGCCAGGGACGGTGG + Intronic
1172455730 20:35071434-35071456 CAGGGCCTGGCATGGGGTGGGGG - Intronic
1172498114 20:35403899-35403921 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1172639604 20:36432729-36432751 CAGGGTCAGGGGTGGGATGAGGG + Intronic
1172696875 20:36829010-36829032 CAGGGCCAGCCTAGGGCAGGTGG - Intronic
1172965731 20:38833294-38833316 CAGGGACAGGAGTGGGTTGGAGG + Intronic
1173093663 20:40002377-40002399 CAAGGCCAGTAGGGGGATGGGGG + Intergenic
1173160149 20:40646494-40646516 CAGGGCCAGGCTAGGGGGTGGGG + Intergenic
1173235312 20:41239756-41239778 CAGTGCCAGGTGAAGGGTGGAGG - Intronic
1173576050 20:44113521-44113543 AAGGGTCAGGCAAGGGAGGGAGG + Intronic
1173576086 20:44113679-44113701 CAGGGCCAGGAGAGGCCTCGGGG - Intronic
1173785040 20:45786805-45786827 CAGGAGCAGGCCAGGCATGGTGG + Intronic
1173987899 20:47276692-47276714 CAGTGCCATGCAAGAGATGGAGG - Exonic
1173999793 20:47366182-47366204 GAGGACCAGGCCAGGCATGGTGG + Intergenic
1174175157 20:48639915-48639937 GAGGGCCAGGGAAGGGACGGAGG + Intronic
1174503562 20:51002762-51002784 CAGTGCCAGGCGTGGGGAGGGGG - Intergenic
1174543619 20:51308496-51308518 CAGGTCCAGGGGAGGGAAGAAGG + Intergenic
1174770360 20:53293728-53293750 CAGGTCCTGGCCAGGCATGGTGG + Intronic
1174908575 20:54579933-54579955 CAGGGCCTGTCGGGGGATGGAGG - Intronic
1175220721 20:57414985-57415007 CAGGGCCAGGGCAGAGCTGGGGG + Intergenic
1175375837 20:58523355-58523377 TAGGGCCGGGGGAGGGAGGGAGG + Intergenic
1175490803 20:59380072-59380094 CAGGGACAGGGGAGGGATCAGGG + Intergenic
1175699236 20:61125157-61125179 CAGGCCCAGGAAAGGGGTGGCGG + Intergenic
1175894914 20:62331762-62331784 AAGTGCCAGGCCAGGTATGGTGG + Intronic
1175910828 20:62404774-62404796 CTGGGCAAGGCAAGGGGTGGTGG + Intronic
1176094819 20:63335767-63335789 CAGAGCCAGGTGAGGGAAAGAGG - Intergenic
1176097319 20:63350066-63350088 AGGGTCCAGGCGAGGGGTGGGGG + Exonic
1176194084 20:63829142-63829164 CAGGGGCTGGGGAGGGACGGAGG + Intronic
1176216915 20:63952354-63952376 GCTGGCCAGGCGAGGGACGGAGG + Intronic
1176242310 20:64080751-64080773 CCGGGCCAGGGGAGGGGCGGGGG - Intronic
1176301606 21:5101478-5101500 CAGGGGCAGGGCAGGGATGCAGG + Intergenic
1176975554 21:15316858-15316880 CAGGGCCTGTCGGGGGCTGGGGG - Intergenic
1177104439 21:16937206-16937228 GAGGGCCTGTCGAGGGGTGGGGG - Intergenic
1177136957 21:17314906-17314928 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1178220917 21:30658985-30659007 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1178533826 21:33396558-33396580 AAGGACCAGGCGGGGGGTGGGGG - Intergenic
1178714583 21:34952214-34952236 CGGGGCCTGTCGGGGGATGGGGG + Intronic
1178813216 21:35903719-35903741 CAGGGCCTGTTGAGGGGTGGAGG + Intronic
1178876930 21:36420848-36420870 AAGGGCCAGGCCAGAGACGGAGG - Intergenic
1178954353 21:37008983-37009005 AAGGGCCAGACGCGGGGTGGGGG - Intronic
1179056787 21:37943801-37943823 CAGGCTCAGGGGAGAGATGGAGG - Intergenic
1179561897 21:42220567-42220589 CATGGCCAGGCGGTGGGTGGAGG + Intronic
1179582576 21:42352708-42352730 CAGGGCCAGGAGAGTGAGAGAGG - Intergenic
1179788878 21:43744163-43744185 CAGGGCCAGGCTAGGGAGTGGGG + Intronic
1179788895 21:43744207-43744229 CAGGGCCAGGCTAGGGAGTGGGG + Intronic
1179855425 21:44160421-44160443 CAGGGGCAGGGCAGGGATGCAGG - Intergenic
1179913976 21:44464602-44464624 GAGGGCCAGGCGAGGGTGGGAGG - Intergenic
1180074576 21:45456113-45456135 CAGGGCCTGCCCAGGGAGGGAGG - Exonic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180280529 22:10689419-10689441 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1180655219 22:17414667-17414689 CAGGGCCAGTCGTGGGGTGGGGG - Intronic
1180656641 22:17427013-17427035 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1180682621 22:17638878-17638900 CAGGGCCAGGTGAGGGGAGTGGG + Exonic
1180959623 22:19756737-19756759 CCGGGCCAGGTGAGGGAGGGAGG + Exonic
1181386159 22:22547322-22547344 CAGCCACAGGCCAGGGATGGAGG + Intergenic
1181618926 22:24074509-24074531 CAAGGCCAAGGGTGGGATGGAGG - Intronic
1182092287 22:27604038-27604060 CAGTGCCAGCCCAGGGAGGGGGG - Intergenic
1182458873 22:30470366-30470388 CAGGTCCAGAGGAGGGAAGGGGG - Intronic
1182695595 22:32197560-32197582 CAGGGCCTGTCGTGGGATGGGGG - Intronic
1182700928 22:32237501-32237523 CAGGGCAAGGCAAGGGAAGTAGG - Intronic
1182715132 22:32352256-32352278 CAGGGCCTGTTGTGGGATGGGGG + Intergenic
1182751423 22:32644854-32644876 CCGGGAAAGGGGAGGGATGGGGG + Intronic
1183293435 22:37016686-37016708 CAAGGCCAGGAGAGGGCTGCAGG + Intronic
1183306536 22:37085940-37085962 CAGGTCCAGGCGAGTGAGGAGGG + Intronic
1183306599 22:37086242-37086264 CTGGGGCAGGGGAGGGGTGGTGG - Intronic
1183309401 22:37101295-37101317 CAGGGGCAGGCGGGTGCTGGGGG + Intronic
1183360715 22:37381780-37381802 GAGCTCCAGGCTAGGGATGGTGG + Intronic
1183379303 22:37482994-37483016 CAGGGAGAGGCTAGGGCTGGTGG - Intronic
1183443371 22:37836557-37836579 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1183467441 22:37986805-37986827 CAGGGCCTGGGATGGGATGGAGG - Intronic
1183530154 22:38348925-38348947 CAGGGACGGGCAAGGTATGGAGG + Intronic
1183538277 22:38415622-38415644 CAGGGCAGGGCGCGGGAGGGCGG + Intergenic
1183603563 22:38854462-38854484 CAGGGCCCGTCAAGGGGTGGAGG - Intergenic
1183739708 22:39662882-39662904 CAGGGCCAGGCCTGGGGTGAGGG + Intronic
1183744260 22:39684329-39684351 CATGGGCAGGAGAGGGCTGGAGG - Exonic
1183915630 22:41116368-41116390 CAGGGCCTGCTGGGGGATGGGGG - Intronic
1184029457 22:41883325-41883347 CAGAGCCAGGCAAGTGATGTAGG + Intronic
1184066784 22:42125862-42125884 CAGGGCCAGGCTGGCGCTGGAGG - Intergenic
1184069252 22:42138014-42138036 CAGGGCCAGGCTGGCGCTGGAGG - Intergenic
1184107483 22:42376667-42376689 CAGAGCCCGGCCAGGGGTGGTGG - Intergenic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184685287 22:46094046-46094068 CAGGCCCAGGCTAGAGCTGGCGG + Intronic
1184996866 22:48213656-48213678 CTGTGCCGGGCAAGGGATGGAGG + Intergenic
1185029209 22:48432766-48432788 AAGGGCCTGGTGAGGGCTGGAGG - Intergenic
1185054788 22:48573979-48574001 CTGTGCCAGGTGAGGGATGAAGG + Intronic
1185304138 22:50103254-50103276 CAGGAGCAGGCCAGGGCTGGGGG - Intronic
1185379828 22:50503268-50503290 CAGGGCCAGGCACAGGTTGGGGG - Exonic
949636820 3:5991504-5991526 CAGGGCCCGTTGGGGGATGGGGG + Intergenic
949945554 3:9187115-9187137 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
949987009 3:9549406-9549428 CAGGAACAGGCCAGGCATGGTGG + Intronic
950070656 3:10149398-10149420 CAGGCCCTGGCCAGGCATGGTGG - Intronic
950193225 3:10992380-10992402 GCGGGGCAGGCGAGGGAAGGAGG + Intergenic
950302416 3:11892401-11892423 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
950598461 3:14008134-14008156 CAGGACCAAGAGAGAGATGGGGG - Intronic
950755377 3:15166741-15166763 CAGGGCCTGTCGGGGGGTGGTGG + Intergenic
950792106 3:15480334-15480356 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
950871220 3:16231129-16231151 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
951189843 3:19755415-19755437 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
951424066 3:22521308-22521330 CAGGGCCAGCTGGGGGAGGGGGG + Intergenic
951515549 3:23555200-23555222 CAGGACCAGGCTGGGCATGGTGG - Intronic
951520436 3:23606229-23606251 CAAGGCCAGGCGTGTGCTGGAGG + Intergenic
951540122 3:23774652-23774674 TTTGGCCAGGGGAGGGATGGAGG - Intergenic
951705006 3:25535563-25535585 CAGGGCCTGTCGGGGGCTGGGGG - Intronic
952362792 3:32647463-32647485 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
952430418 3:33218517-33218539 GTGGGCCAGGAGAGGGATGCTGG + Intronic
952605972 3:35146800-35146822 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
953397056 3:42581832-42581854 CCGGGCGAGGTGAGGGCTGGCGG - Exonic
953875232 3:46662799-46662821 CAGGGCCTGACCAGGGATGAAGG + Intergenic
953919169 3:46940081-46940103 CAGGGCTAGGCATGGGAGGGAGG + Intronic
953988842 3:47467878-47467900 CAGGGCCTGCCGGGGGATGGGGG - Intronic
954112811 3:48444868-48444890 CAGTGCCAGGCAAGGGGTTGGGG + Intergenic
954155678 3:48683773-48683795 CAGGGCCAGGGGAGGGCTGGGGG - Intronic
954391269 3:50269263-50269285 CAGGGCCAGGCCCGGGATCACGG - Exonic
954457186 3:50606206-50606228 CACTGCCAGGCGAGGGCTCGGGG - Intergenic
954473866 3:50724674-50724696 CGGGGCCTGTCGGGGGATGGGGG + Intronic
954476381 3:50750208-50750230 CAGGGCCAGGTCAGGGATGAGGG - Intronic
954488987 3:50883105-50883127 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
954531612 3:51325900-51325922 CAGGGCCTGTCAGGGGATGGGGG + Intronic
954534223 3:51346292-51346314 CAGGGCCTGTCGTGGGGTGGTGG - Intronic
954930700 3:54278822-54278844 CAGGGCCTGTCGGGGGATGGGGG + Intronic
955163693 3:56490020-56490042 CAGGACCAGGGGAAGGTTGGAGG - Intergenic
955479649 3:59376665-59376687 CAAGGCCAGGCCAGTGTTGGAGG + Intergenic
955832272 3:63016693-63016715 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
956001259 3:64732244-64732266 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
956047706 3:65214109-65214131 CAGGGCCTGTCGAGGGGTGGGGG - Intergenic
956048032 3:65217445-65217467 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
956169240 3:66419674-66419696 GTGGGCCAGGAGAGAGATGGCGG + Intronic
956600414 3:71014979-71015001 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
956787208 3:72652552-72652574 CAGGTCCAGGCAAGAGATGTGGG + Intergenic
956888733 3:73588088-73588110 CAGGGCCTGTTGAGGGGTGGAGG - Intronic
957564749 3:81870087-81870109 TAGGGGCATGCTAGGGATGGAGG - Intergenic
957583281 3:82104282-82104304 TAGGGCCTGTTGAGGGATGGGGG - Intergenic
957786651 3:84890971-84890993 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
957917343 3:86703444-86703466 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
958087351 3:88827387-88827409 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
958661030 3:97067853-97067875 CAGGGATAGGCCAGGCATGGTGG + Intronic
959006939 3:101030323-101030345 CAGGGCCAGTTGGGGGGTGGGGG - Intergenic
959030492 3:101294245-101294267 CAGGGCTAGTCGGGGGGTGGGGG - Intronic
959059677 3:101604763-101604785 CAGGGCCTGTCGGGGGTTGGGGG - Intergenic
959203311 3:103275759-103275781 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
959246833 3:103881421-103881443 CAGGGCCTGTCGAGGGGCGGGGG - Intergenic
959255787 3:104011787-104011809 CAATGCCAGGCCAGGCATGGTGG + Intergenic
959361173 3:105394322-105394344 AAGGGACATGCGAGGGATGAGGG + Intronic
959537382 3:107501577-107501599 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
959576271 3:107937808-107937830 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
959679494 3:109076815-109076837 CAGGGCCTGGCGGGGGATCGGGG + Intronic
960127636 3:114017722-114017744 CAGGGCCTGTTGAGGGGTGGAGG + Intronic
960138818 3:114132394-114132416 CAGGGCCTGTCAAGGGATGGGGG + Intronic
960377554 3:116922232-116922254 CAGGGCCTGTTGTGGGATGGGGG - Intronic
960580380 3:119273223-119273245 CAGGGCCCATCGAGGGGTGGGGG + Intergenic
960881723 3:122352373-122352395 CTGAGCCAGGCCAGGCATGGTGG + Intergenic
961265272 3:125636582-125636604 CAGGACCAGGCCAGGCATGGTGG - Intergenic
961369611 3:126421553-126421575 CAGGGCCCGGGCAGGGATGTAGG - Intronic
961813355 3:129534508-129534530 CAAGGCCAGACCAGGGCTGGGGG + Exonic
961921792 3:130434091-130434113 CAGGGCCTGTCGAGGGGTGGGGG - Intronic
961937487 3:130600698-130600720 CAGGGCCAGTCGGGGGTTGGTGG + Intronic
961997611 3:131262816-131262838 CAGGGCCTGTCGGGGGTTGGGGG - Intronic
962146189 3:132842549-132842571 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
962204654 3:133424919-133424941 CAGAACCAGGCCAGGCATGGTGG - Intronic
962343707 3:134605124-134605146 CAGAGCAAGGGGAGAGATGGGGG - Intronic
962513314 3:136125031-136125053 CAAGTCCAGGCCAGGCATGGTGG + Intronic
962553019 3:136514900-136514922 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
962676129 3:137760038-137760060 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
962713837 3:138110289-138110311 CAGGGCCTGTTGGGGGATGGAGG + Intronic
962767275 3:138577183-138577205 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
963181591 3:142362606-142362628 AAAGGCCAGGGGAGGGATGGAGG - Intronic
963766141 3:149337847-149337869 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
964014760 3:151931090-151931112 CAGTGCCAGACCAGGCATGGTGG - Intergenic
964066272 3:152583653-152583675 AAGGGGCAGGGGTGGGATGGGGG + Intergenic
965002685 3:162976557-162976579 CAGGGCCTGTCGTGGGATGGGGG - Intergenic
965194830 3:165580376-165580398 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
965393591 3:168134271-168134293 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
965973040 3:174586986-174587008 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
966055210 3:175678712-175678734 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
966342933 3:178945605-178945627 CAGGACCAAGTGAGAGATGGGGG + Intergenic
966570791 3:181440851-181440873 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
966818061 3:183905370-183905392 CAGAGCAAGGAGAGTGATGGAGG + Intergenic
966915699 3:184583163-184583185 CAGGAACAGGCGGGGGAGGGGGG + Intronic
966919913 3:184604519-184604541 CGGGGCCGGGCGAGGGTGGGTGG + Intronic
967035515 3:185646002-185646024 GAGGGACAGGGGAGGGAGGGAGG + Intronic
967052328 3:185796273-185796295 CAGGGATAGGCGGGGCATGGTGG + Intronic
967387958 3:188928921-188928943 CTGGGCCAGGCCAGGTGTGGTGG + Intergenic
967422157 3:189285320-189285342 CAGGCCTAGGCGAGGAAAGGCGG + Intronic
967463700 3:189777482-189777504 CAGGGTGAGGCCAGGCATGGTGG - Intronic
968005988 3:195243198-195243220 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
968470864 4:781707-781729 CGGGGCCAGGCGAGGGCACGGGG + Intergenic
968551582 4:1226243-1226265 CAGGGACAAGCCAGGGATGAGGG - Intronic
968576622 4:1369243-1369265 CAGCCCCAGGCGAGGGCTGGAGG + Intronic
968763164 4:2452773-2452795 GAAGGCCAGGCCAGGCATGGTGG + Intronic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969244471 4:5923562-5923584 CAGGGCTGGGCGAGGGATCGGGG + Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
970033726 4:11707817-11707839 CAGGGCCTGTTGGGGGATGGGGG - Intergenic
970736974 4:19182763-19182785 CAGGGCCTGTCAAGGGGTGGGGG + Intergenic
970859061 4:20681430-20681452 GAGGGCCAGGGGAGGGGTGAGGG - Intergenic
971395341 4:26221932-26221954 CAGGGCGGTGAGAGGGATGGGGG + Intronic
971431434 4:26572131-26572153 CAGAACCAGGCGCGGGAAGGAGG - Intergenic
971561253 4:28082177-28082199 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
972315628 4:37923109-37923131 CAGGGCCTGTCAAGGGGTGGGGG - Intronic
972769507 4:42184088-42184110 CAGGGACAGGCCAGGGGTTGAGG + Intergenic
972958315 4:44419689-44419711 CGGGGCCTGTCGGGGGATGGGGG + Intronic
973220784 4:47723709-47723731 CAGGGCAAGGCCAGGCACGGTGG + Intronic
973348273 4:49080424-49080446 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
973670609 4:53213808-53213830 CAGGGCCTGTCGTGGGGTGGTGG - Intronic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
973886332 4:55325641-55325663 CTGGGCCAGGAGAGGGACAGGGG + Intergenic
974140910 4:57885709-57885731 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
974371671 4:61023988-61024010 TGGGGCCAGTCGTGGGATGGGGG + Intergenic
974567689 4:63599298-63599320 CAGTTCCAGGCCAGGCATGGTGG + Intergenic
974604904 4:64139632-64139654 CAGGGGCAGTTGGGGGATGGGGG - Intergenic
974945908 4:68528754-68528776 CAGGGGCAGGCGGGAGATAGTGG - Intergenic
975138732 4:70899424-70899446 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
975269154 4:72408904-72408926 CAGGGCCGGTCGGGGGGTGGGGG + Intronic
975526386 4:75354871-75354893 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
975644422 4:76532060-76532082 CAGGGCCTGTCATGGGATGGGGG - Intronic
975943391 4:79675277-79675299 CAGGGCCTGTCGTGGGGTGGTGG + Intergenic
976387642 4:84480022-84480044 CAGTGCCAGGTGAGGGGTGCAGG + Intergenic
976790799 4:88876129-88876151 CAGGGCCTGTCCTGGGATGGGGG + Intronic
976964644 4:91022154-91022176 CAGGGCCTGGTGTGGGGTGGGGG - Intronic
977272278 4:94931878-94931900 CAGGGCCTGACTAGGGTTGGTGG + Intronic
977339024 4:95734156-95734178 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
977517252 4:98035934-98035956 CAGGGCCTGTCGAGGGGTGGGGG + Intronic
977582324 4:98739094-98739116 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
977625629 4:99186986-99187008 CACAGCCAGGCCAGGCATGGTGG - Intergenic
978541580 4:109821982-109822004 CTGGGCCTGTCGGGGGATGGGGG + Intronic
978607934 4:110503057-110503079 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
979044215 4:115840219-115840241 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
979240101 4:118440351-118440373 CAGGCCCAGATGAGGGAAGGGGG - Intergenic
979368684 4:119856846-119856868 CAGGCTCAGGCCAGGCATGGTGG + Intergenic
979572390 4:122243451-122243473 CAAGTCCAGGCCAGGCATGGTGG + Intronic
979787761 4:124738011-124738033 CAGAGCCAGGAGAGAGATTGAGG + Intergenic
979820292 4:125162095-125162117 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
980540541 4:134187531-134187553 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
980902783 4:138920933-138920955 CAGGGTCAGGCCAGGTGTGGTGG + Intergenic
980991001 4:139738254-139738276 CATGGTCAGGCCAGGCATGGTGG + Intronic
981014973 4:139964427-139964449 CAGGGCCTGATGGGGGATGGGGG + Intronic
981202475 4:141997026-141997048 CAGGGCCTGTCAAGGGGTGGAGG - Intergenic
981263212 4:142747858-142747880 CAGGGCCTGTCAAGGGGTGGGGG + Intronic
981395528 4:144244295-144244317 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
981613753 4:146624208-146624230 CAGGGCTAGGCTGGGCATGGTGG - Intergenic
981656394 4:147116653-147116675 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
981761886 4:148203642-148203664 CGGGGCGGGGGGAGGGATGGGGG - Intronic
981884134 4:149652284-149652306 CAGGGCCTGTTGAGGGGTGGAGG + Intergenic
981949840 4:150392837-150392859 CAGGGCCTATCGAGGGGTGGGGG + Intronic
981962117 4:150553305-150553327 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
982036893 4:151354722-151354744 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
982453274 4:155577410-155577432 AAGGGGCAGGGGAGGTATGGAGG - Intergenic
982523479 4:156449638-156449660 CAGGGCCTGTCAGGGGATGGAGG - Intergenic
982579291 4:157157493-157157515 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
983464520 4:168070245-168070267 CAGGGCCTGTCGTGGGTTGGGGG + Intergenic
983507574 4:168571937-168571959 CAGTGCCAGGCCGGGCATGGTGG + Intronic
984638653 4:182141052-182141074 TAGGGCTAGGCGAGGGTTGCTGG + Intergenic
984766929 4:183406865-183406887 CGGGGACTGGCGAGGGGTGGGGG + Intergenic
984767999 4:183414168-183414190 CAGGGGGAGGCCTGGGATGGAGG - Intergenic
984807638 4:183766312-183766334 CCCGGCCAGGCCATGGATGGTGG + Intergenic
985108632 4:186523952-186523974 CAGGGCCTGTTGTGGGATGGGGG - Intronic
985113826 4:186572098-186572120 CAGGGACAGGCCAGGTGTGGTGG + Intergenic
985639941 5:1058913-1058935 CTGGGCCAGGTGGGGGTTGGAGG - Intronic
985672789 5:1214813-1214835 CAGGGCCTGGGTAGGGAGGGTGG + Intronic
985683222 5:1267822-1267844 CAGGGCCTGTCATGGGATGGGGG + Intronic
985778315 5:1856909-1856931 CAGGGCCGGGTGAGAGACGGTGG + Intergenic
985842467 5:2318787-2318809 CAGGGCCAGCCAGGGGTTGGGGG - Intergenic
986284268 5:6348254-6348276 CAGGGCCGTGCTAGGGCTGGAGG + Intergenic
986520889 5:8616895-8616917 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
986665288 5:10097280-10097302 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
987052913 5:14163168-14163190 CAGGGCCTGTCCAGGGATGGGGG - Intronic
987128490 5:14838101-14838123 CAGGGCCTGACGTGGGGTGGGGG + Intronic
987610060 5:20191515-20191537 CAGGGCCTGTTGGGGGATGGGGG - Intronic
987714560 5:21550656-21550678 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
987808750 5:22805811-22805833 CGGGGCCTGTCGAGGGGTGGGGG - Intronic
987889128 5:23853502-23853524 CAGGGCCTGTTGGGGGATGGGGG - Intergenic
987969198 5:24920391-24920413 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
988061988 5:26183197-26183219 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
988064453 5:26217478-26217500 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
988402643 5:30781368-30781390 CAGGGCCTGTCAAGGGGTGGGGG + Intergenic
988529417 5:32014620-32014642 CAGGGCCATGGGTGGTATGGGGG - Intronic
988608186 5:32700549-32700571 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
988820262 5:34876826-34876848 CAGGGCCTGTCGGGGGCTGGGGG + Intronic
988835920 5:35032237-35032259 CAAGGCCCGGCGGGGCATGGTGG - Intronic
989091614 5:37739797-37739819 CAGGGCCAGTCGGGGTATGGGGG - Intronic
989357543 5:40561545-40561567 CAGGGCCAGTCAGGGGGTGGGGG - Intergenic
989402934 5:41028026-41028048 CAGGGCCCGTCGTGGGGTGGGGG + Intronic
989649089 5:43667420-43667442 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
989785176 5:45318402-45318424 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
989813774 5:45710816-45710838 CAGGGCCTGTTGCGGGATGGGGG + Intergenic
990068973 5:51755652-51755674 CAGGGCCTGTTGTGGGATGGGGG - Intergenic
990100737 5:52183287-52183309 CAGGGCCTGTCGAGGGATGAGGG + Intergenic
990238127 5:53789802-53789824 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
990305156 5:54487146-54487168 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
990316942 5:54591524-54591546 CAGAGCCATGCAAGGGAAGGTGG + Intergenic
990623745 5:57588683-57588705 CAGGGCCTGTCATGGGATGGGGG + Intergenic
991489066 5:67165752-67165774 CAGGGCCAGGCCGGGGCTTGTGG - Exonic
991562056 5:67964301-67964323 CAGCCCCAGGTGAGGGATGAGGG - Intergenic
991691636 5:69231087-69231109 CAGGGCCAGGCCGGGTGTGGTGG + Intergenic
991691942 5:69233960-69233982 CAGGGCAGGGGCAGGGATGGAGG - Intergenic
992335201 5:75760213-75760235 CGGGGCCTGTCGAGGGATGGGGG - Intergenic
992471602 5:77061764-77061786 GAGGGCCTGGGGAAGGATGGTGG + Exonic
992513684 5:77469230-77469252 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
992738389 5:79746835-79746857 CAGTGTCAGGACAGGGATGGAGG - Intronic
992828205 5:80569925-80569947 CAGGGCCAGCCGAGGGCCGCCGG - Intronic
992829459 5:80580317-80580339 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
992936656 5:81714060-81714082 CAGGGCCTGTTGGGGGATGGGGG - Intronic
993329669 5:86582081-86582103 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
993437770 5:87919141-87919163 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
993496875 5:88617601-88617623 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
993512856 5:88793797-88793819 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
993566030 5:89476889-89476911 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
993657288 5:90593439-90593461 CAGGGCCTGCCGTGGGGTGGGGG + Intronic
993780211 5:92057004-92057026 CAGGGCCTGTTGTGGGATGGGGG - Intergenic
993888843 5:93448037-93448059 CAGGGCCTGTCGTGGGGTGGAGG + Intergenic
994063130 5:95504069-95504091 GAGGCCCAGGCGGGGGGTGGGGG + Intronic
994241270 5:97424355-97424377 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
994523288 5:100869999-100870021 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
994693296 5:103044619-103044641 CAAGCCCAGGCCAGGCATGGTGG + Intergenic
995745579 5:115399354-115399376 CAGGGCCTGTCAAGGGGTGGGGG - Intergenic
995993790 5:118274431-118274453 CAGGGCCTGTCGTGGGTTGGGGG + Intergenic
996416535 5:123216840-123216862 AAGGGCCAGGCCAGGCATGATGG + Intergenic
996937792 5:128967914-128967936 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
996986621 5:129574425-129574447 CAAGGCCTGTCGAGGGATTGGGG - Intronic
997361461 5:133297897-133297919 CTGGTCCAGATGAGGGATGGGGG - Intronic
997365896 5:133324982-133325004 CATGGCCAGGCTAGGGGTGGTGG + Intronic
997602868 5:135152284-135152306 GAGGGCCAGGAGAGGGAATGAGG + Intronic
997662837 5:135602766-135602788 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
998125762 5:139620004-139620026 CAGGACCAAGAGAGAGATGGGGG + Intronic
998157088 5:139793229-139793251 CAGGGTCAGGCTGGGAATGGTGG - Intergenic
998415898 5:141945848-141945870 AAGGGCCAGGCGGGTGAGGGTGG + Intronic
998644815 5:144050091-144050113 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
998691025 5:144588594-144588616 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
998696320 5:144643934-144643956 CAGGACCTGGTGAGGGGTGGGGG - Intergenic
998751556 5:145327937-145327959 CAGGGCCTGTTGGGGGATGGGGG - Intergenic
998800691 5:145865848-145865870 TAGGGCCAGGCCAGGCACGGTGG + Intronic
998934003 5:147214942-147214964 CAGGGCTAGGCCCGGCATGGTGG - Intergenic
1000021484 5:157322708-157322730 CAGTGCCAGGCATGTGATGGGGG + Intronic
1000047802 5:157535927-157535949 CAGGGGCAGGGGTGGGATGGGGG - Intronic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1000144330 5:158438949-158438971 CAGGGCCTGTTGAGGGATGGGGG - Intergenic
1000364234 5:160476316-160476338 CAGGGACAGGTGGGGGCTGGGGG + Intergenic
1000411796 5:160941229-160941251 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1000467469 5:161597526-161597548 CAGGGCCTGTCACGGGATGGGGG + Intronic
1000596213 5:163217954-163217976 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1000674858 5:164108140-164108162 CAGGGGCAGGGGATGGATAGGGG + Intergenic
1000759789 5:165208003-165208025 CAGCACCAGGCCAGGCATGGTGG - Intergenic
1000913186 5:167046858-167046880 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1001054245 5:168436128-168436150 GAGGGCCAGGCCAGGCACGGTGG - Intronic
1001289110 5:170443887-170443909 CAGGCCCAGGGCAGGGGTGGGGG + Intronic
1001739724 5:174042509-174042531 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1001984271 5:176060848-176060870 CAGGCACTGGCGCGGGATGGCGG - Intronic
1002189238 5:177470189-177470211 CAGGGCCAGGCTGGGGCTGGGGG - Intronic
1002262774 5:178006564-178006586 CAGGCACTGGCGCGGGATGGCGG - Intronic
1002306350 5:178286190-178286212 CTGGGCCTGGTGAGGGATGAGGG - Intronic
1002740355 5:181430934-181430956 CAGGCCCAGATGAGGGAAGGGGG - Intergenic
1003093933 6:3127424-3127446 AAGGGCCAGGGGAGGAAGGGTGG + Intronic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003410518 6:5858072-5858094 CAGGGCCTGTTGTGGGATGGGGG - Intergenic
1003530035 6:6929436-6929458 CAAGGCCTGGCAGGGGATGGTGG - Intergenic
1003860458 6:10317998-10318020 CATGGCCATGCGAGGGAAGCAGG - Intergenic
1003911404 6:10747433-10747455 CTGGGCCAGGCCAGAGGTGGAGG - Intergenic
1004103420 6:12639502-12639524 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1004312536 6:14558268-14558290 CCGGGCCTGTCGGGGGATGGGGG - Intergenic
1004465041 6:15877146-15877168 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1004502984 6:16225706-16225728 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005068861 6:21845736-21845758 CAGGGGAAGGTGAGGGATGTGGG + Intergenic
1005184803 6:23153391-23153413 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1005479316 6:26240523-26240545 TCGGGCCAAGCGACGGATGGCGG - Exonic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1005781537 6:29197973-29197995 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1005817822 6:29570686-29570708 CAGGTCCAGAAGAAGGATGGTGG + Intronic
1005832736 6:29683552-29683574 TAGGGCCAGGCCAGGCACGGTGG - Intergenic
1006218273 6:32465075-32465097 CAGGGTGAGGCCAGGGCTGGAGG - Intergenic
1006377301 6:33678568-33678590 CTGGACGAGGCGGGGGATGGGGG + Intronic
1006385996 6:33731246-33731268 CAGGGCCAGGGGAGTGCTGGAGG - Intronic
1006507515 6:34498976-34498998 CAGGGTTAGGGGAGGGTTGGGGG + Intronic
1006509616 6:34514994-34515016 CTGGGCCAGGCCAGGGCTGGAGG - Intronic
1006521526 6:34573784-34573806 TAGGGCCAGGACAGGGAAGGGGG + Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006948184 6:37799610-37799632 CAGGGCAGGGCAAGGGCTGGTGG - Intergenic
1007180640 6:39926980-39927002 CATGGCCAGGGGTGGGGTGGTGG - Intronic
1007271586 6:40641397-40641419 CTGGGCCAGGCCAAGGATGGTGG + Intergenic
1007485529 6:42178435-42178457 GAGGGCCCGGCCAGGGCTGGGGG + Intronic
1007626109 6:43247243-43247265 CAGGACCCGGCGAGGGGAGGAGG - Intronic
1007720848 6:43884755-43884777 CAGGGGCAGGCAGGGGAGGGAGG - Intergenic
1007844854 6:44745462-44745484 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
1007850563 6:44798882-44798904 CAGGGCCAGGCCAAGGTGGGTGG + Intergenic
1008324490 6:50161389-50161411 CAGGGCCTGTTGGGGGATGGGGG - Intergenic
1008401486 6:51068644-51068666 CAGGAACAGGAGAGAGATGGGGG + Intergenic
1008450653 6:51646805-51646827 AAAGGCCAGGCAAGGGATGGTGG - Intronic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008591637 6:52999271-52999293 CAGGGCCAGTCGGGGGGTGGGGG + Intergenic
1008843039 6:55927749-55927771 CAGGGCCTGTCAGGGGATGGGGG - Intergenic
1009801018 6:68536560-68536582 CAGGGCCTGTCTGGGGATGGGGG - Intergenic
1009916205 6:70000016-70000038 CAGGGGCTGTTGAGGGATGGAGG - Intronic
1009947924 6:70361272-70361294 CAGGGCCTGTCGTGGGATGGGGG + Intergenic
1010251102 6:73708151-73708173 CGGGGCCTGTCGTGGGATGGGGG - Intronic
1010347712 6:74831471-74831493 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1010350004 6:74862150-74862172 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1010421597 6:75682558-75682580 CAGGGCCTGTTGTGGGATGGAGG - Intronic
1010467496 6:76186266-76186288 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1011063737 6:83301034-83301056 CAGGGCCTGCCATGGGATGGGGG + Intronic
1011072756 6:83403654-83403676 CAGGGCCTGTCGTGGGGTGGAGG - Intronic
1011721982 6:90166894-90166916 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1011725779 6:90209041-90209063 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1011735634 6:90308168-90308190 CCGGGCCTGCCGAGGGGTGGGGG + Intergenic
1012162054 6:95898335-95898357 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1012183851 6:96189217-96189239 CAGGGAGAGGTGAGGGCTGGTGG + Intronic
1012363793 6:98414821-98414843 CAGGGCCTGTCAAGGGGTGGGGG + Intergenic
1012481362 6:99670952-99670974 CAGGGCCAGTCGTGGGGTGGGGG - Intergenic
1012761999 6:103314465-103314487 CAGGGCCTGTTGAGGGATGGGGG - Intergenic
1012808557 6:103927532-103927554 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1012933839 6:105344668-105344690 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1013123892 6:107164319-107164341 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1013394857 6:109725256-109725278 CAGGGCCTGTCGAGGGGTGGGGG - Intronic
1013653798 6:112224449-112224471 CAGAGCCAGACGATGGATGGAGG - Intronic
1013740946 6:113283917-113283939 CAGGGCCTGTTGGGGGATGGAGG + Intergenic
1013810146 6:114035450-114035472 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1014480850 6:121935041-121935063 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1015331761 6:131988134-131988156 CAGGGCCTGTCATGGGATGGGGG - Intergenic
1015358721 6:132310834-132310856 CAGGGCCTGTTGGGGGATGGGGG + Intronic
1015790058 6:136957613-136957635 CAGGGCCAGGAAAGGCAGGGAGG - Intergenic
1015790072 6:136957655-136957677 CAGGGCCAGGAAAGGCAGGGGGG - Intergenic
1015832883 6:137388756-137388778 GAGGGTCAGGCCAGGCATGGTGG + Intergenic
1016462059 6:144287152-144287174 CAGGGTCAGGGGAGAGGTGGAGG + Intronic
1016575143 6:145561887-145561909 CAGGGCCAGTCGGTGGGTGGAGG + Intronic
1017038078 6:150285132-150285154 CAGGGCAGGGCGGGGGGTGGTGG + Intergenic
1017105141 6:150880260-150880282 CAGAGGCTGGAGAGGGATGGGGG - Intronic
1017290619 6:152731523-152731545 CAGGGCCTGTCGTGGGATAGCGG - Intergenic
1017377284 6:153786038-153786060 CAGGGCCTGTTGGGGGATGGAGG + Intergenic
1017581415 6:155868651-155868673 CAGGGCCTGTCGGGGGGTGGAGG - Intergenic
1017660895 6:156671392-156671414 CGGGGCCAGTCGTGGGGTGGGGG + Intergenic
1017792764 6:157815876-157815898 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1018582443 6:165318707-165318729 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1018760512 6:166890824-166890846 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1018998000 6:168724830-168724852 CAAGGCCAGGTCAGGGCTGGAGG - Intergenic
1019245466 6:170706538-170706560 CAGGCCCAGATGAGGGAAGGGGG - Intergenic
1019465593 7:1186393-1186415 AAATGCCAGGGGAGGGATGGAGG - Intergenic
1019505116 7:1386714-1386736 CCAGGCCAGACGCGGGATGGCGG - Intergenic
1019573482 7:1724967-1724989 CAGGGCCATGCCCGGCATGGTGG - Intronic
1019698894 7:2463077-2463099 CAGGGGCAGGGGAGGGAATGGGG + Intergenic
1020660350 7:10974119-10974141 CAGGGCCAGGCGAGGCCGGGGGG + Exonic
1020833512 7:13120978-13121000 CAGGGCCTGTTGAGGGGTGGGGG - Intergenic
1021115040 7:16737978-16738000 GAGGGGCAGGCCAGGCATGGTGG - Intergenic
1021148268 7:17116860-17116882 CAGGGCCTGTTGAGGGGTGGAGG - Intergenic
1021240059 7:18189330-18189352 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1021797629 7:24273133-24273155 CGGGGCCTGTCGTGGGATGGGGG - Intergenic
1022043407 7:26602428-26602450 CAGTGCCAGGCATAGGATGGGGG + Intergenic
1022506131 7:30909641-30909663 CAGGGACAGGTGAGGGGAGGAGG + Intergenic
1022867995 7:34442857-34442879 CAGGGCCTGTCGAGGGGTGGGGG + Intergenic
1022978276 7:35578253-35578275 GAGGGCCTGTCGAGGGATAGGGG - Intergenic
1023453998 7:40318722-40318744 GAAGGCCAGGCCAGGCATGGTGG - Intronic
1023815555 7:43947031-43947053 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1023922134 7:44637973-44637995 CTGGGCCAGGGGAGGGGTGCGGG - Intronic
1024119668 7:46224006-46224028 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1024270124 7:47635720-47635742 CAGGGCCAGGACAGGGAAGGAGG + Intergenic
1025018042 7:55456787-55456809 CAGGGCCTGTCGGGGGATGGGGG + Intronic
1025243343 7:57296611-57296633 CCGGGCGAGGCCAGGCATGGTGG + Intergenic
1025917038 7:65873701-65873723 CGGGGCCAGGCGGGGGGCGGCGG + Intronic
1026731387 7:72914659-72914681 CAGTGTCAGGCCAGGCATGGTGG - Intronic
1026765253 7:73155736-73155758 CCGGCCCAACCGAGGGATGGGGG - Intergenic
1026808072 7:73440225-73440247 CAGGGCCAGGAGAGGCTTGGAGG + Intergenic
1026905733 7:74061811-74061833 CAGGGCAAGCTTAGGGATGGTGG - Intronic
1026941263 7:74289376-74289398 CAGGGGCGGGCGCGGGAGGGCGG - Intergenic
1027041727 7:74965492-74965514 CCGGCCCAACCGAGGGATGGGGG - Intronic
1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG + Intergenic
1027112651 7:75453141-75453163 CAGTGTCAGGCCAGGCATGGTGG + Intronic
1027125876 7:75556337-75556359 CTTGGCCAGGCCAAGGATGGTGG + Intronic
1027284896 7:76637746-76637768 CAGTGTCAGGCCAGGCATGGTGG + Intergenic
1027495393 7:78881416-78881438 CGGGGCCTGTCGTGGGATGGGGG + Intronic
1027563109 7:79757448-79757470 CAGAGCCAGTCGAGGGGTGGGGG - Intergenic
1027945121 7:84734649-84734671 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1028288442 7:89034403-89034425 CAGGGCCTGGCGGGGGGTAGGGG - Intronic
1028386227 7:90256366-90256388 CAGGGCCTGTCAGGGGATGGGGG + Intronic
1028392057 7:90327988-90328010 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1028567213 7:92246236-92246258 CAGCGGCCGGAGAGGGATGGGGG + Exonic
1029062830 7:97816321-97816343 CAGGGCCTGTCATGGGATGGAGG + Intergenic
1029211876 7:98916030-98916052 CAGGGCCAGGGGAGGGGGGCAGG - Intronic
1029257312 7:99278306-99278328 CAGGGAAAGTCCAGGGATGGTGG + Intergenic
1029270719 7:99375178-99375200 CGGGGCAAGGCTGGGGATGGGGG - Intronic
1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG + Intronic
1029606600 7:101602851-101602873 CAGGGTGAGGGGTGGGATGGGGG - Intergenic
1029611164 7:101627345-101627367 CAGGGGCAGGGGTGGGAGGGAGG + Intronic
1029660129 7:101954882-101954904 CAGGTTCAGGCCAGGCATGGTGG + Intronic
1030483324 7:110132354-110132376 CAGGGCCTGTCGTGGGGTGGTGG - Intergenic
1031008430 7:116499667-116499689 CAGGGCTAGGCGAGGCGAGGGGG + Exonic
1031052809 7:116961938-116961960 CAGGGCCAGTCAGGGGGTGGGGG - Intronic
1031923027 7:127615113-127615135 CAGGGACAGGTGAGGCATGATGG + Intronic
1032016215 7:128381820-128381842 GAGGGCCTGGCGGGGGGTGGGGG - Intergenic
1032377568 7:131437227-131437249 CAGGGACTGTCGAGGGGTGGGGG - Intronic
1032399182 7:131611761-131611783 CAGGGGCAGGCCGGGCATGGTGG - Intergenic
1032471532 7:132182531-132182553 GAGGACCAGGGGAAGGATGGAGG - Intronic
1032500909 7:132398965-132398987 CAGGGCCAGCTGAGGAGTGGAGG - Intronic
1032980332 7:137274515-137274537 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1033214569 7:139483875-139483897 CGGGGCCAGGCGAGGGTTGCAGG + Intergenic
1033529080 7:142245104-142245126 AAGGGCCAGGCCAGGGAAGGGGG + Intergenic
1033584255 7:142762539-142762561 CATGGGCAGGAGAGGGATGGGGG - Intronic
1033587539 7:142785870-142785892 CAGGGCCAGGGTAGTGATGGGGG + Intergenic
1034004863 7:147459980-147460002 CAGGGCCTGTCAGGGGATGGTGG + Intronic
1034192090 7:149220783-149220805 CAGGGCCATGCATGGGTTGGGGG + Intronic
1034193362 7:149227431-149227453 CAGAGACAGGCCAGGCATGGTGG + Intergenic
1034345727 7:150384154-150384176 CAGGGCCAGGCGTGGGAAGGGGG + Intronic
1034491703 7:151396391-151396413 CAGGGGCAGGCAAGGAAGGGTGG - Intronic
1034774990 7:153817754-153817776 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1035117159 7:156534163-156534185 CAGTGCCGGGAGTGGGATGGTGG - Intergenic
1035343595 7:158182476-158182498 CAGGGCCTGCTGAGGGTTGGGGG - Intronic
1035502659 8:101667-101689 CAGGCCCAGATGAGGGAAGGGGG + Intergenic
1035541309 8:440740-440762 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1035566594 8:645171-645193 CAGTGCCAGCCGAGGGAAAGGGG - Intronic
1036131515 8:6118569-6118591 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1036778729 8:11631287-11631309 CAGGGGCAGCCTATGGATGGTGG - Intergenic
1036837171 8:12082246-12082268 CAGGGCCAGTCAGGGGATGGGGG + Intergenic
1036858964 8:12328491-12328513 CAGGGCCAGTAAGGGGATGGGGG + Intergenic
1037033837 8:14142155-14142177 CAGGGCCTGTCGAGGGGTGGAGG + Intronic
1037206261 8:16323251-16323273 CAGGGCCTGTCAGGGGATGGGGG + Intronic
1037880279 8:22570260-22570282 CAGGGGAAGGCAAGGGCTGGAGG + Intronic
1037920079 8:22799706-22799728 CAGGGCCTGTCGTGGGATTGGGG - Intronic
1038126738 8:24682248-24682270 CAGGGCCTGTCGGGGGATGGGGG - Intergenic
1038605114 8:28993879-28993901 CAGGGGAAGGCCAGGCATGGTGG + Intronic
1038929534 8:32177546-32177568 CAGGGCCTGTCAAGGGATGGGGG - Intronic
1038956716 8:32475696-32475718 CAGGCACAGGCTAGGCATGGTGG - Intronic
1039155127 8:34546218-34546240 CAGGGCCTGTTGTGGGATGGGGG + Intergenic
1039199286 8:35070534-35070556 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1039457284 8:37715886-37715908 CATGCCCAGGAAAGGGATGGGGG + Intergenic
1039518317 8:38151143-38151165 CAGGGCCAGGCGAGGGATGGAGG + Exonic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1039808590 8:41024829-41024851 CAGGGCCTGCCGGGGGTTGGGGG + Intergenic
1039830928 8:41213723-41213745 CCGGGCCTGTCGGGGGATGGGGG + Intergenic
1039832904 8:41230942-41230964 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1040672263 8:49705811-49705833 CAGGGCCTGTCGTGGGGTGGAGG - Intergenic
1040844834 8:51826354-51826376 CAGGGCCTGTCAAGGGATGGGGG + Intronic
1040984464 8:53278835-53278857 CAGGGCCTGTTGTGGGATGGGGG - Intergenic
1041446898 8:57962141-57962163 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1041780841 8:61577164-61577186 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1042326564 8:67534870-67534892 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1042666321 8:71210471-71210493 CAGTGCCAGGCTAAGGAAGGTGG + Intronic
1042806520 8:72776239-72776261 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1042939756 8:74095849-74095871 CAGGGACAGGTGTGGGCTGGAGG - Intergenic
1042959856 8:74292014-74292036 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1043129664 8:76445652-76445674 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1043432782 8:80210832-80210854 CTGGGCTAGGCCAGGGGTGGTGG + Intronic
1044548824 8:93489215-93489237 CAGGGCCTGTCGTGGGATGGGGG + Intergenic
1045200278 8:99973502-99973524 CAGGGCCTGTCAGGGGATGGTGG + Intronic
1045378765 8:101601980-101602002 CAGGGCCTGTCGAGGGGTGGGGG - Intronic
1045716356 8:105050520-105050542 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1045742741 8:105381079-105381101 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
1045849039 8:106671806-106671828 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1045997805 8:108383809-108383831 CAGGGCCTGCTGAGGGGTGGAGG - Intronic
1046085838 8:109434087-109434109 CAGGGCCTGTCGAGGGGTTGGGG + Intronic
1046191835 8:110806307-110806329 CAGGGCCTGTCGGGGGATTGGGG - Intergenic
1046436233 8:114192937-114192959 CCGGGCCTGTCGTGGGATGGGGG + Intergenic
1046499758 8:115060405-115060427 CAGGGCCTGTCGAGGGGTGGGGG + Intergenic
1046559209 8:115816360-115816382 CAGGACCAGGTGTGGGATGCGGG - Intergenic
1046572308 8:115981618-115981640 CAGGGCCTGTCGGGTGATGGGGG + Intergenic
1046847999 8:118940168-118940190 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1046863412 8:119119652-119119674 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1046865998 8:119151058-119151080 CAGAGGCAGGCCAGGCATGGTGG - Intergenic
1047134230 8:122057333-122057355 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1047169471 8:122477071-122477093 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1047204916 8:122795354-122795376 CAGGGCTAGGCCAGGGAGGCAGG - Intronic
1047383067 8:124382280-124382302 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1047549156 8:125850819-125850841 CAGGGCCAGTTGGGGGTTGGGGG + Intergenic
1047615193 8:126557682-126557704 CAGGGCCAGGCGAAGGGCTGGGG - Intronic
1047757012 8:127926616-127926638 CAGAGCCAGGCAAGGGAAGGAGG - Intergenic
1047862020 8:128977462-128977484 CAGGGCCTGTTGGGGGATGGAGG + Intergenic
1048051970 8:130826903-130826925 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1048202141 8:132383360-132383382 CAGGGCCAGGGCAGCGAGGGAGG + Intronic
1048349445 8:133604164-133604186 CAGTCCCAGGTGAGGGATTGGGG - Intergenic
1048381444 8:133869326-133869348 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1048424213 8:134307668-134307690 CAGGGCCTGTTGTGGGATGGGGG - Intergenic
1048562450 8:135555888-135555910 CAGCTCCTGTCGAGGGATGGGGG - Intronic
1048592680 8:135835763-135835785 CGGGGCCTGTTGAGGGATGGAGG - Intergenic
1048796979 8:138159592-138159614 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1048844385 8:138593205-138593227 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1048899217 8:139021964-139021986 CAGGGCCAGGAGAGGGAGAGGGG + Intergenic
1049047014 8:140160633-140160655 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1049156091 8:141067674-141067696 AAGGGCCAGGTCAGGGTTGGGGG + Intergenic
1049165295 8:141121985-141122007 CAGGGGCAGGCGGGGTGTGGAGG - Intronic
1049179710 8:141216033-141216055 GGGGGCGAGGGGAGGGATGGTGG - Intronic
1049408743 8:142463185-142463207 CAGGGCCTGGGGAGGGATGGAGG - Intronic
1049605927 8:143529171-143529193 CAGGGCCAGTCGAGAGAAAGCGG + Intronic
1049684151 8:143932601-143932623 CAGGGCCAGCCGGGGGAGGTGGG - Intronic
1049748129 8:144271599-144271621 CAGGGCAAGGCCAGGGCGGGAGG + Intronic
1049812187 8:144580572-144580594 CAGGGCCAGGTGAGGGCGGTGGG - Intronic
1050603613 9:7277838-7277860 CAGGGCCTGTCATGGGATGGGGG - Intergenic
1050781212 9:9338845-9338867 CAGGGCCTGTCGAGGGGTGAGGG - Intronic
1050871679 9:10579076-10579098 CAGGGCCTGTCAAGGGGTGGAGG - Intronic
1050887524 9:10784258-10784280 CAGGGCCCGTCGTGGGGTGGGGG + Intergenic
1051070431 9:13159614-13159636 CAGTGACAGGCAGGGGATGGGGG + Intronic
1051125462 9:13798499-13798521 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1052068317 9:24050602-24050624 CAGGGCCGGTCATGGGATGGGGG - Intergenic
1052165002 9:25315403-25315425 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1052285385 9:26778869-26778891 CAGGGCCTGTCGTGGGGTGGTGG + Intergenic
1052314787 9:27105168-27105190 AAGGGTCAGGCTAGGCATGGTGG - Intergenic
1052416367 9:28183292-28183314 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1052459417 9:28743337-28743359 CGGGGCCTGTCGGGGGATGGGGG - Intergenic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1052657597 9:31382858-31382880 CAGGGCCTGTTGGGGGATGGGGG - Intergenic
1052901431 9:33797674-33797696 CATGGGCAGGAGAGGGATGTGGG - Intronic
1053176226 9:35926604-35926626 CAGGACCAGGCCAGGCGTGGTGG - Intergenic
1053696675 9:40645577-40645599 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1053943090 9:43275765-43275787 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1054307925 9:63444808-63444830 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1054440282 9:65254266-65254288 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1054992514 9:71345577-71345599 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1055062016 9:72078800-72078822 CAGGGCCTGTCAAGGGGTGGGGG + Intergenic
1055176227 9:73321015-73321037 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1055208977 9:73766199-73766221 CAGGGCCAGTCGGGGGTGGGGGG + Intergenic
1055754250 9:79540504-79540526 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1056190956 9:84183301-84183323 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1056482197 9:87016766-87016788 CAAGTCCAGGAGAGGGATAGAGG + Intergenic
1056567131 9:87783527-87783549 CAGAGCCAGGTGACAGATGGTGG - Intergenic
1056641545 9:88375822-88375844 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1056668604 9:88603309-88603331 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1056856050 9:90130612-90130634 CAGGGCCTGTCGGGGGTTGGGGG - Intergenic
1056938040 9:90932875-90932897 CAAGGCCTTGTGAGGGATGGAGG + Intergenic
1057027541 9:91746362-91746384 CCAGGCCAGGCCAGGCATGGTGG - Intronic
1057225973 9:93293299-93293321 CAGGGACAGGGGAGTGATGAAGG + Intronic
1057238045 9:93381556-93381578 CAAGGACAGGCCAGGCATGGTGG + Intergenic
1057261591 9:93587592-93587614 GAGCCCCAGGTGAGGGATGGAGG + Intronic
1057272860 9:93660481-93660503 CAGGTCCAGGTTGGGGATGGTGG - Exonic
1057460145 9:95253788-95253810 CAGGGCGGGGGCAGGGATGGGGG + Intronic
1058077178 9:100662948-100662970 CAGGGCCTGTTGGGGGATGGGGG - Intergenic
1058208245 9:102134776-102134798 CAGGGCCAGTCGGGGGATGGGGG + Intergenic
1058346645 9:103971536-103971558 CAGGGCCTGGTGGGGGATGGGGG - Intergenic
1058595492 9:106610957-106610979 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1058935151 9:109763256-109763278 TAGGGCCTGGCAATGGATGGTGG - Intronic
1059261532 9:112981702-112981724 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1059414861 9:114156207-114156229 CCGGGCCAGGCGCGGCAGGGCGG - Intronic
1059594915 9:115709215-115709237 CAGGGCCTGCCGTGGGGTGGGGG + Intergenic
1059637677 9:116186965-116186987 GAGGGCAAGGCAAGGGCTGGAGG - Intronic
1059716841 9:116921121-116921143 CAGGACCATGAGAGAGATGGGGG + Intronic
1059978759 9:119746023-119746045 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060270367 9:122135874-122135896 CAGGGCTAGGCCGGGCATGGTGG - Intergenic
1060382509 9:123189686-123189708 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060756693 9:126219189-126219211 CAGGGGGAGGCCAGGGCTGGAGG - Intergenic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061179149 9:129013808-129013830 CAGGGCGAGGCCAGGATTGGAGG - Intronic
1061271893 9:129548524-129548546 AAGGGGCAGACGAGGGAAGGAGG - Intergenic
1061275908 9:129569235-129569257 CGGGGCCAGGCCAGGGAGGGAGG + Intergenic
1061412760 9:130430208-130430230 CAGGGCCAGGCAATGGCTGCAGG + Intronic
1061674429 9:132207814-132207836 CAGGGCAAGGCCAGGCACGGTGG + Intronic
1061674945 9:132210392-132210414 CAGCCCCAGGCGAGTGACGGAGG - Intronic
1061760935 9:132850819-132850841 TAGGGCCAGGCTGGGCATGGTGG - Intronic
1061946274 9:133909910-133909932 CAGGGCAAGGGCAGGGCTGGGGG + Intronic
1062084954 9:134643634-134643656 CAGGGTCAGGAGAGAGTTGGTGG - Intronic
1062092041 9:134683368-134683390 GAGGGCCAGGCCAGGGAGCGGGG + Intronic
1062269513 9:135702184-135702206 CAGGGCAACGCGAGGGAAGAAGG + Exonic
1062391862 9:136337083-136337105 CAGGGCCAGCCCAGGGACCGGGG + Intronic
1062549801 9:137080769-137080791 CAGGGCCTGGCGAGCGGTGCGGG - Exonic
1062698491 9:137887355-137887377 CAGGGGCAGGAGGGAGATGGAGG + Intronic
1202779126 9_KI270717v1_random:19222-19244 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1203605664 Un_KI270748v1:55742-55764 CAGGCCCAGATGAGGGAAGGGGG - Intergenic
1185491529 X:520986-521008 CAGGGCCTGTCGGGGGCTGGGGG + Intergenic
1185519392 X:727700-727722 CAGCTCCAGGGAAGGGATGGAGG - Intergenic
1185679911 X:1880017-1880039 CAGGGCCTGCCGGGGGGTGGGGG + Intergenic
1185724585 X:2409428-2409450 CAGGGCCTGTCGAGGGGTTGAGG - Intronic
1186042795 X:5499917-5499939 CGGGGCCTGTCGAGGGTTGGGGG + Intergenic
1186306964 X:8271924-8271946 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1186318105 X:8392926-8392948 CAGGGCCAATCGGGGGAAGGTGG + Intergenic
1186810832 X:13186972-13186994 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1186901962 X:14066200-14066222 CAGGGCGTGGGTAGGGATGGGGG - Intergenic
1186974157 X:14882000-14882022 CAGGGCCTGGCATGGGGTGGGGG + Intronic
1187183175 X:16962805-16962827 GTGGGCCAGGCCAGGCATGGTGG + Intronic
1187238327 X:17488944-17488966 CAGGGCCTGTCGAGGGGTGTGGG - Intronic
1187975956 X:24705691-24705713 CAGGGGCAGGGGAGGGGGGGAGG - Intronic
1187987572 X:24831199-24831221 CAGGGCCAAGCGATGTTTGGGGG + Intronic
1188120432 X:26299239-26299261 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1188360295 X:29244928-29244950 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1188567283 X:31541491-31541513 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1188633271 X:32395410-32395432 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1188974195 X:36653838-36653860 CAGGGCCTGTTGAGGGGTGGGGG - Intergenic
1189162631 X:38826081-38826103 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1189363180 X:40368995-40369017 CAGGGCCAGGGCCGGGGTGGCGG - Intergenic
1189702054 X:43721842-43721864 CAGGGCCTGTCAGGGGATGGGGG - Intronic
1189938319 X:46093100-46093122 CAGGGCCTGTCGGGGGTTGGGGG + Intergenic
1190429493 X:50365563-50365585 CAGGGCCAGGGGCTGGTTGGGGG - Exonic
1190450197 X:50571717-50571739 CAGGGCCTGTCGGGGGATGGGGG + Intergenic
1190510721 X:51171274-51171296 CAGGGCCAGTCAGGGGGTGGGGG + Intergenic
1190529205 X:51358081-51358103 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1190707106 X:53038469-53038491 CAGGAGCAGGCCAGGCATGGTGG - Intergenic
1191004183 X:55692865-55692887 CGGGGCCTGTCGGGGGATGGAGG + Intergenic
1191121974 X:56915427-56915449 CAGGGCCTGTCATGGGATGGGGG - Intergenic
1191198428 X:57750092-57750114 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1191201462 X:57786976-57786998 CAGGGCCTGTCGGGGGATGGTGG + Intergenic
1191233239 X:58114078-58114100 CAGGGCCTGTTGTGGGATGGAGG + Intergenic
1191261546 X:58327399-58327421 CAGGGCCTGTTGTGGGATGGGGG + Intergenic
1191803316 X:65105241-65105263 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1191822210 X:65323346-65323368 CAGGGCCTGTCGGGGGATGTGGG - Intergenic
1192006858 X:67223560-67223582 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1192137220 X:68614735-68614757 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1192384142 X:70648251-70648273 CAGGGCCTGTTGTGGGATGGGGG + Intronic
1192896147 X:75444456-75444478 CAGGGCCTGTCGTGGGGTGGGGG + Intronic
1192959697 X:76114475-76114497 CGGGGCCTGTCGAGGGGTGGAGG - Intergenic
1193166685 X:78289116-78289138 CAGGGCCTGTCGGGGGGTGGAGG - Intronic
1193340773 X:80346831-80346853 CAGGGCCTGTCCAGGGCTGGGGG - Intronic
1193394766 X:80970481-80970503 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
1193414083 X:81200695-81200717 CGGGGCCAGTCGGGGGGTGGGGG + Intronic
1193559748 X:83003284-83003306 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1193644422 X:84048998-84049020 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1193932110 X:87565950-87565972 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1194132316 X:90096110-90096132 CAGGGACAGGCCAGGCATGGTGG + Intergenic
1194139568 X:90193237-90193259 CAGGGCCTGTCTAGGGGTGGGGG - Intergenic
1194376177 X:93136504-93136526 CAGGGCCTGTCGGGGGTTGGGGG + Intergenic
1194532723 X:95070976-95070998 CAGGGCCTGTCGAGGGTTTGGGG + Intergenic
1194732698 X:97474475-97474497 CAGGGTAAGGCCAGGCATGGTGG + Intronic
1194852494 X:98886763-98886785 CAGGGCCTGTCAGGGGATGGGGG + Intergenic
1194935528 X:99943092-99943114 CGGGGCCTGTCGAGGGGTGGGGG + Intergenic
1194953135 X:100150733-100150755 CAGGGCCTGTCACGGGATGGGGG - Intergenic
1194953744 X:100155703-100155725 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1195001783 X:100649629-100649651 CAGGCCCAGACTAGGGGTGGGGG - Intronic
1195153971 X:102103632-102103654 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195422597 X:104692504-104692526 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1195566080 X:106340369-106340391 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1195948541 X:110241648-110241670 CAGGGCCTGTCGGGGGGTGGGGG + Intronic
1196186452 X:112749570-112749592 CAGGGCCTGTCGTGGGGTGGAGG - Intergenic
1196303958 X:114079005-114079027 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1196312987 X:114189882-114189904 CAGGGCCTGTCGGGGGGTGGGGG + Intergenic
1196574986 X:117306566-117306588 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197736562 X:129853802-129853824 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1197792329 X:130268560-130268582 CAGGGCCCGGCGCAAGATGGTGG + Intronic
1198128548 X:133671808-133671830 CGGGGCCTGGCGTGGGATGGGGG - Intronic
1198191502 X:134311377-134311399 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1198201502 X:134423949-134423971 CAGGGCCGGTCGTGGGATGGGGG + Intronic
1198225962 X:134646196-134646218 CAAGGCCAGGTGAAGGGTGGAGG + Intronic
1198527079 X:137512284-137512306 CAGGGCCTGTCGCGGGGTGGGGG + Intergenic
1198717455 X:139573507-139573529 CAGGAGCAGGAGAGTGATGGGGG - Intergenic
1198764573 X:140067666-140067688 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1198949608 X:142055906-142055928 CAGGGCCTGTCGTGGGGTGGGGG - Intergenic
1199059542 X:143338276-143338298 CAGGGCCTGTCGGGGGGTGGGGG - Intergenic
1199451753 X:147985471-147985493 CAGGGCCTGTCGAGGGGTTGGGG - Intronic
1199788185 X:151124614-151124636 CAGGGCCTGTTGTGGGATGGGGG + Intergenic
1199801765 X:151258824-151258846 CGGGGCCTGTCGAGGGGTGGGGG + Intergenic
1199852687 X:151736803-151736825 CAGGGCCAGGCCAGTGCTGGGGG - Intergenic
1199911274 X:152289669-152289691 CAGGGCCTGTCGTGGGGTGGGGG - Intronic
1199995059 X:153018572-153018594 CAGGGCCTGTCGTGGGGTGGGGG + Intergenic
1200088108 X:153620747-153620769 CAGGCCCAGCTGATGGATGGTGG - Intergenic
1200107786 X:153724450-153724472 CGGGGCCTCGCGAGGGCTGGTGG - Intronic
1200226164 X:154419067-154419089 CAGGGCCTGGCTGGGGAGGGAGG + Intronic
1200358554 X:155578055-155578077 CAGGCCCAGGAGGGAGATGGGGG + Intronic
1200478114 Y:3666198-3666220 CAGGGACAGGCCAGGCGTGGTGG + Intergenic
1200485311 Y:3762186-3762208 CAGGGCCTGTCTAGGGGTGGGGG - Intergenic
1201286367 Y:12382025-12382047 CAAGGTCAGGCCAGGCATGGCGG - Intergenic
1201332945 Y:12847630-12847652 CAGGGCCTGTCGGGGGGTGGGGG - Intronic
1201398334 Y:13574015-13574037 CAGGGCCTGTTGGGGGATGGGGG + Intergenic
1201721342 Y:17100924-17100946 CAAGGCCATCCCAGGGATGGTGG - Intergenic