ID: 1039518317

View in Genome Browser
Species Human (GRCh38)
Location 8:38151143-38151165
Sequence CAGGGCCAGGCGAGGGATGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1619
Summary {0: 1, 1: 0, 2: 11, 3: 150, 4: 1457}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039518298_1039518317 29 Left 1039518298 8:38151091-38151113 CCGTTTGTGGGGAGCTTGGGGCG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1039518317 8:38151143-38151165 CAGGGCCAGGCGAGGGATGGAGG 0: 1
1: 0
2: 11
3: 150
4: 1457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039518317 Original CRISPR CAGGGCCAGGCGAGGGATGG AGG Exonic