ID: 1039524608

View in Genome Browser
Species Human (GRCh38)
Location 8:38203092-38203114
Sequence ACAACTTCTCCAGATATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039524608_1039524613 -1 Left 1039524608 8:38203092-38203114 CCCTACATATCTGGAGAAGTTGT 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1039524613 8:38203114-38203136 TAGTAAGGGGAAACTTTTAAAGG No data
1039524608_1039524615 7 Left 1039524608 8:38203092-38203114 CCCTACATATCTGGAGAAGTTGT 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1039524615 8:38203122-38203144 GGAAACTTTTAAAGGGAAAGAGG No data
1039524608_1039524614 0 Left 1039524608 8:38203092-38203114 CCCTACATATCTGGAGAAGTTGT 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1039524614 8:38203115-38203137 AGTAAGGGGAAACTTTTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039524608 Original CRISPR ACAACTTCTCCAGATATGTA GGG (reversed) Intronic
900914499 1:5625936-5625958 ACAAGTTATCCATATATGTGTGG - Intergenic
906915143 1:50001373-50001395 AAAAATTCACCAGAGATGTAAGG - Intronic
907919713 1:58901244-58901266 CCACCTTCTCCAGACCTGTAGGG - Intergenic
908449978 1:64244249-64244271 ACAACTTTGCAAGATAGGTAAGG - Exonic
917114069 1:171584175-171584197 ACATCTTCTCCAGGTAAGTCAGG + Exonic
917683332 1:177390706-177390728 ACAACTTCTTCAGTTCTGCATGG + Intergenic
919186912 1:194162818-194162840 ACAACATCAGCAGATATTTAAGG + Intergenic
920026313 1:203000078-203000100 ACATCTTCTCCAGGGATGTCAGG - Intergenic
921061508 1:211589133-211589155 CCAACATCTCCATATGTGTAAGG - Intergenic
1063917732 10:10901369-10901391 ATCAGTTTTCCAGATATGTAAGG - Intergenic
1065484998 10:26228818-26228840 ACAATTTTTCCACATATGGAAGG - Intronic
1073379721 10:103068710-103068732 ACAGCCTCTCCAGGTATGTTTGG + Exonic
1075119984 10:119657716-119657738 AGAGCTTCTCCAGACCTGTAAGG - Intronic
1076517334 10:131054375-131054397 ATAACCTCACCAGATATTTATGG - Intergenic
1079828618 11:25232131-25232153 ATAACTTTTGCAGATATTTATGG + Intergenic
1082884975 11:58071677-58071699 CAAACTTCTCCAGATATGAGTGG + Intronic
1091371396 11:135062499-135062521 GCAACTTCCCAAAATATGTAAGG + Intergenic
1092179979 12:6439878-6439900 ACAAATTTTCCAGATCTGTGGGG - Intergenic
1094086592 12:26600052-26600074 AGAAATTCTGCAGAAATGTATGG + Exonic
1097808485 12:63991741-63991763 ACAATTTATCCAAATTTGTATGG + Intronic
1100040324 12:90309707-90309729 AACACTTCACCAGATATGTGAGG - Intergenic
1100280112 12:93110345-93110367 ACAACTTCTCCAGAAATCCTAGG - Intergenic
1107621918 13:42241852-42241874 AAAAATTCTCTAGATATTTATGG + Intronic
1112251099 13:97781341-97781363 ACAGCTCCTCCAGAAATGTCAGG - Intergenic
1116046392 14:39748697-39748719 ACAGCCTCTTCAGATATATAAGG + Intergenic
1120140000 14:80919221-80919243 ACAACTTCACCAGATATAAATGG + Intronic
1120238746 14:81924834-81924856 ACAACTTCACCAGGTATCTGAGG - Intergenic
1123964564 15:25441830-25441852 ACAACTTCACCAGCAATTTAGGG - Intergenic
1131640137 15:94283474-94283496 ACAACCCCCCCAGATATTTAAGG - Intronic
1133214773 16:4285273-4285295 ACAAGATTTCCTGATATGTAGGG + Intergenic
1133617972 16:7496913-7496935 ACAACTTCTTCACATCTGTATGG - Intronic
1134319794 16:13152270-13152292 ACAACCTCTCCTGACTTGTATGG - Intronic
1148728750 17:49817111-49817133 AAAGCTTCTGCAGATAAGTAAGG + Intronic
1150940856 17:69692669-69692691 ACATCTCCTCCAAATATGAATGG + Intergenic
1155441910 18:25870840-25870862 ACAGCTCCTTCAGATATGCAAGG - Intergenic
1155880555 18:31143262-31143284 TCAACTTCTTAAGATAAGTAAGG - Intronic
1156751640 18:40464552-40464574 ACATCATAACCAGATATGTAAGG + Intergenic
1156808162 18:41212577-41212599 AGGACTTCTCCAGAGATTTAGGG + Intergenic
1158587164 18:58750576-58750598 ACAAGTTGACCAGAAATGTATGG - Intergenic
1159861035 18:73649395-73649417 GAAAGTTCTCCTGATATGTATGG - Intergenic
1165646270 19:37440808-37440830 TTCACTTCTCCAGAAATGTAGGG - Intronic
929100246 2:38304587-38304609 ACAACTTTTCCAGACATAGACGG + Intronic
931819547 2:65937350-65937372 ACACCTACTCCAGATAAGCATGG - Intergenic
938652391 2:133396996-133397018 GCAACTTCTGTAAATATGTAAGG + Intronic
943240257 2:185375889-185375911 TCAACTTCTCCTAATATATATGG - Intergenic
945358589 2:208868018-208868040 ACAGCTTCTGTAGATATCTATGG - Intergenic
946222118 2:218236878-218236900 ATAACTTCACCAGAACTGTATGG - Intronic
947666502 2:231909213-231909235 ACAACCTCTCTAGATATGGGTGG + Intergenic
1169954384 20:11084889-11084911 GCAAAATCTACAGATATGTATGG + Intergenic
1169991085 20:11503134-11503156 ACAATTTCTCCATAGATGGAAGG - Intergenic
1171050215 20:21851077-21851099 ACAACTTTTCCACAGATGGATGG + Intergenic
1173458184 20:43220569-43220591 ACATCATCTCCAGAAATGTAGGG - Intergenic
1173695943 20:45012643-45012665 ACAACTACTGTAGATATTTATGG + Intronic
1176970912 21:15264620-15264642 AAAATTTCTCCAGAGATGAATGG + Intergenic
1177004819 21:15658538-15658560 TCAAATTTTACAGATATGTAAGG - Intergenic
1178314550 21:31558040-31558062 ACAACTTCTCCAGGTTTCGAGGG + Intronic
1178479472 21:32967199-32967221 GCAACTTCCCCAGATCTGGAAGG + Intergenic
1179551175 21:42144954-42144976 ACAACTTCTACAGACATCCAAGG - Intergenic
1182172169 22:28242458-28242480 ACAACCTCTCTAGATTTTTATGG - Intronic
1182709689 22:32312728-32312750 ACAACTTCTACAGAGATGCCAGG - Intergenic
1183563683 22:38597194-38597216 ACAACTTCTCCAGGTATGGAAGG - Exonic
1184397250 22:44249593-44249615 ACAACTTCTACAGAGATGCCAGG - Exonic
952636385 3:35537710-35537732 AGAACTTCACCCGAGATGTAAGG + Intergenic
954627851 3:52032407-52032429 ACCTATTCTCCAGATATGTGTGG - Intergenic
956676916 3:71743802-71743824 ACAAATTGTCCATATATGTGTGG - Intronic
956959425 3:74381032-74381054 ACAATTTCTCCAGCTTTCTAAGG - Intronic
957934964 3:86930538-86930560 ACAACTTCTTCAGATATTAATGG - Intergenic
958085068 3:88796086-88796108 CCAACTTCCACAGATCTGTAGGG + Intergenic
959589074 3:108056032-108056054 ACTACTTCACCAGAGTTGTATGG + Intronic
960308334 3:116089827-116089849 ACCACTTCTCCAGATCTTTCAGG + Intronic
960938051 3:122915430-122915452 CCAACTGCTCCAGGTATGTGAGG - Exonic
962417645 3:135197990-135198012 ACCACATATCAAGATATGTAGGG - Intronic
964148296 3:153492973-153492995 AGTACTTCATCAGATATGTATGG - Intronic
964902514 3:161676724-161676746 AGAACTTCTCTAGATCTGCATGG - Intergenic
965734255 3:171804146-171804168 AAAACATTTCCAGATGTGTAGGG - Intronic
966819359 3:183912949-183912971 ACAACCTCTCCAAACAGGTAGGG - Intergenic
967582928 3:191180487-191180509 TAAACTTCACCAGATATTTAGGG + Intergenic
971613375 4:28755901-28755923 ACAAATTCTCCAGGGATATAGGG - Intergenic
972254212 4:37335772-37335794 ACAACTTTTCCACAGAGGTAGGG - Intronic
975222900 4:71833713-71833735 AGGACTTCTCCAGAAATGTCAGG - Intergenic
975370622 4:73582188-73582210 GCAACTTCTCCAAAAATTTAAGG - Exonic
975891561 4:79035155-79035177 TCAAATTCTCCAGTTATGTTTGG - Intergenic
976936759 4:90645477-90645499 ACATTTTATCTAGATATGTAGGG + Intronic
978769509 4:112439728-112439750 ACAAATTCTCCCAGTATGTAAGG - Exonic
979507092 4:121510695-121510717 ACAACCTCTCAGGATGTGTAAGG + Intergenic
981876508 4:149552839-149552861 ACAACTGCTTCAGAGATCTAGGG - Intergenic
983767361 4:171501058-171501080 AGTTCTTCTTCAGATATGTAGGG + Intergenic
985011146 4:185583363-185583385 ATAACTTATCCAGACATGTAAGG - Intergenic
987189152 5:15455901-15455923 ACAACTTCACCATAAATGTGTGG + Intergenic
988082969 5:26435889-26435911 GCAACTTCTCCTGAACTGTAAGG - Intergenic
988642279 5:33053641-33053663 ACAACTTACCAAGATAAGTAAGG + Intergenic
995018717 5:107342950-107342972 ACAACCTCTCCAGACCTGGATGG + Intergenic
995712072 5:115045815-115045837 AAAACATCCCCAGATATTTAAGG - Intergenic
996340324 5:122430644-122430666 ACATTTTCTACAGACATGTATGG + Intronic
996670824 5:126114930-126114952 ACCACTTGTGCAAATATGTACGG - Intergenic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
1004340148 6:14801172-14801194 TCAAATTCTCCAGTTATGGATGG + Intergenic
1004603397 6:17172398-17172420 ACAACTTCTCCTGATATGTGAGG + Intergenic
1009676452 6:66829446-66829468 CCAAGTTATCCAGATATTTAGGG - Intergenic
1014851470 6:126344265-126344287 CCAACTTCCCCCAATATGTAAGG - Intronic
1015096655 6:129422532-129422554 ACAACTTCTGCAGATAGTAAAGG + Intronic
1016169942 6:141000101-141000123 GGGACTTTTCCAGATATGTAAGG - Intergenic
1016435162 6:144029432-144029454 AAAGCTTCTACAGATAAGTAAGG + Intronic
1016783114 6:147981873-147981895 ACCACTTCTCCAGCTATCAATGG + Intergenic
1018552362 6:165012316-165012338 ACAAGTGCTGCAGAGATGTAAGG + Intergenic
1019875878 7:3810163-3810185 AAAACTGCTCCAGATATGGGGGG - Intronic
1021065480 7:16167246-16167268 CCAACTTCTCCAAATTTGTAAGG + Intronic
1023504668 7:40887291-40887313 ACACAGTCTCCAAATATGTATGG - Intergenic
1023608292 7:41949449-41949471 ACAACTTCCCAATTTATGTAAGG + Intergenic
1023992328 7:45135695-45135717 ACAAGTTCTACTCATATGTATGG + Intergenic
1024860469 7:53834477-53834499 CCAACTTCCACAGATATCTAGGG - Intergenic
1031320957 7:120326680-120326702 ACATGTTCTGCAAATATGTATGG + Intronic
1034035950 7:147822287-147822309 ACAACATCTCCATGTATCTACGG - Intronic
1036602474 8:10274534-10274556 ATAACTTCTCCAGATTGGAATGG - Intronic
1037034011 8:14143786-14143808 ACTACTGCTGCAGAGATGTAGGG - Intronic
1037109936 8:15153901-15153923 ACAAGTTTTCCAGGGATGTAGGG + Intronic
1037436113 8:18865390-18865412 ACAACTTCTCCAAATCAGCAAGG + Intronic
1039524608 8:38203092-38203114 ACAACTTCTCCAGATATGTAGGG - Intronic
1040082163 8:43297343-43297365 CCAAATCTTCCAGATATGTATGG + Intergenic
1041305402 8:56452457-56452479 ACAACATATCCTGATATATAGGG - Intergenic
1041913518 8:63115276-63115298 TTAACTTCTCCAGGTATGTTGGG + Intergenic
1042483254 8:69326112-69326134 CCACCTTCTCCACATGTGTACGG - Intergenic
1043305650 8:78791059-78791081 ATCACTTCACCAGAGATGTATGG - Intronic
1043859252 8:85296982-85297004 ACAACTTATCCAGAAAATTAAGG - Intergenic
1045611270 8:103845758-103845780 ACAACATCTCCAGTTTTTTATGG + Intronic
1050654020 9:7805309-7805331 ACATATTCTAAAGATATGTATGG + Intronic
1055253149 9:74332764-74332786 ACAACTAGTTCAGATATGTCTGG + Intergenic
1055254407 9:74350336-74350358 ATCACTTATCCATATATGTATGG + Intergenic
1057867458 9:98692714-98692736 ACAGTTTCTCCAGGTATGAATGG + Intronic
1057958271 9:99429903-99429925 TCAACTTCTTCATATATTTATGG + Intergenic
1059056218 9:110983414-110983436 ACAAATACTCCACATATATAAGG + Intronic
1061344137 9:130008395-130008417 ATTACTCCTCCAGATAGGTATGG + Intronic
1187973779 X:24685096-24685118 ATAACTTCTCATTATATGTATGG + Intergenic
1191732807 X:64355475-64355497 ACAACTTCTCCAGAGATTAATGG + Intronic
1198206418 X:134469388-134469410 ACAACTTCTTGACATAAGTATGG + Intronic
1199147428 X:144385314-144385336 ACGACTTATCCATATATGTGAGG + Intergenic
1199890910 X:152080960-152080982 ATAAATTCTCCAAATATGTATGG - Intergenic