ID: 1039527891

View in Genome Browser
Species Human (GRCh38)
Location 8:38232131-38232153
Sequence CAGACTTACCTCAGCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039527891_1039527899 28 Left 1039527891 8:38232131-38232153 CCAGGGTGGCTGAGGTAAGTCTG 0: 1
1: 1
2: 1
3: 14
4: 199
Right 1039527899 8:38232182-38232204 GCCGGCGTCTGCCGTCCCGCCGG No data
1039527891_1039527895 -10 Left 1039527891 8:38232131-38232153 CCAGGGTGGCTGAGGTAAGTCTG 0: 1
1: 1
2: 1
3: 14
4: 199
Right 1039527895 8:38232144-38232166 GGTAAGTCTGTGTGGGGAAAAGG No data
1039527891_1039527897 10 Left 1039527891 8:38232131-38232153 CCAGGGTGGCTGAGGTAAGTCTG 0: 1
1: 1
2: 1
3: 14
4: 199
Right 1039527897 8:38232164-38232186 AGGACAATGGAGCCGAAAGCCGG No data
1039527891_1039527901 29 Left 1039527891 8:38232131-38232153 CCAGGGTGGCTGAGGTAAGTCTG 0: 1
1: 1
2: 1
3: 14
4: 199
Right 1039527901 8:38232183-38232205 CCGGCGTCTGCCGTCCCGCCGGG No data
1039527891_1039527896 -3 Left 1039527891 8:38232131-38232153 CCAGGGTGGCTGAGGTAAGTCTG 0: 1
1: 1
2: 1
3: 14
4: 199
Right 1039527896 8:38232151-38232173 CTGTGTGGGGAAAAGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039527891 Original CRISPR CAGACTTACCTCAGCCACCC TGG (reversed) Intronic
900237105 1:1598137-1598159 CATCCTCACCCCAGCCACCCCGG - Exonic
901402832 1:9026080-9026102 CAGCATTCGCTCAGCCACCCTGG + Intronic
904636277 1:31884075-31884097 CCCACTGAGCTCAGCCACCCTGG - Intergenic
905886277 1:41493810-41493832 CAGACTGACCTCGACCACCCTGG + Intergenic
915151610 1:153836955-153836977 AAGACTTACCTCAGACATTCAGG - Intronic
920695099 1:208175760-208175782 CAGCCTGACCTCTGCCAACCAGG - Intronic
922416694 1:225428317-225428339 CCGCCTTATCTCAGCCGCCCAGG + Intronic
922943138 1:229486084-229486106 CAGCCTCACCTCAACCTCCCGGG - Intronic
924383117 1:243481329-243481351 CAGGATTACCTAAGCCACCAAGG - Intronic
1067469807 10:46528184-46528206 CGCACTAACCTCAGCCACCAGGG + Intergenic
1067777010 10:49171140-49171162 CAGCCTTACCTCAGTCCCCTAGG - Intronic
1069867319 10:71511848-71511870 AAGACTGCCATCAGCCACCCAGG - Intronic
1070388964 10:75952092-75952114 CAGACTCATCTCAGAAACCCTGG + Intronic
1070649730 10:78226203-78226225 CAAGCTGACCTCACCCACCCAGG - Intergenic
1073420016 10:103417195-103417217 CAGAGTTTCCTCTGTCACCCAGG + Intronic
1075035853 10:119066481-119066503 CAGTCTTAACTCTGCCCCCCAGG - Intronic
1075786724 10:125054992-125055014 CAGAGTTAACTCAGGCACCCTGG + Intronic
1075900384 10:126038284-126038306 CAGGCTCACCTCGGCCACCTTGG - Exonic
1075983339 10:126760614-126760636 CACACTTACCTCATTCACTCTGG - Intergenic
1075986409 10:126789243-126789265 CAGAATTTCCTCTGTCACCCAGG - Intergenic
1076121962 10:127943639-127943661 CAGAGTCACCTCAGCTGCCCTGG - Intronic
1077285468 11:1763504-1763526 CAGACTGACCGCAGCCTCCCTGG - Intronic
1077856750 11:6134047-6134069 CAGACTGACCTCAAACTCCCTGG - Intergenic
1081660592 11:44885728-44885750 CAGGCTTTTCTCAGCCACGCAGG + Intronic
1081993686 11:47350702-47350724 CAGACTTTCCTCATCCACAGCGG - Intronic
1083424033 11:62573822-62573844 CAAACTTACCCCAGCCGCCATGG + Exonic
1084438173 11:69156070-69156092 CTGCCTTCCCGCAGCCACCCTGG - Intergenic
1084519345 11:69654149-69654171 CACGCTTACCTCAACCATCCTGG + Exonic
1088279013 11:108118480-108118502 CTGTCCTACCTCAGCCTCCCAGG + Intergenic
1090381153 11:126328551-126328573 GAGACCTGCCCCAGCCACCCAGG - Intronic
1091339605 11:134800267-134800289 CTGACCTCCCTCAGCCACCGTGG + Intergenic
1091642964 12:2251468-2251490 CTGACCTACCTCAACCTCCCTGG - Intronic
1091919263 12:4291122-4291144 CAGGCTTACCTCTGGCACCCCGG + Intronic
1093582131 12:20794771-20794793 CTCACTAACCTCAGCCTCCCAGG - Intergenic
1094360759 12:29628686-29628708 CAGACTTCGCTCTGTCACCCAGG + Intronic
1099220918 12:79912666-79912688 CAGGCTTTCCTCTGTCACCCAGG - Intronic
1100115042 12:91294211-91294233 CAGACTCACAGCAGCCACTCAGG + Intergenic
1101246036 12:102885316-102885338 GAGACTGACCCCAGCGACCCAGG + Intronic
1103519114 12:121525931-121525953 CATACTGGCCTCTGCCACCCTGG + Intronic
1105298720 13:19114310-19114332 CAGAGGTGCCTCTGCCACCCAGG - Intergenic
1106467147 13:30023446-30023468 CAGACAGACTGCAGCCACCCTGG - Intergenic
1108172004 13:47751272-47751294 CAGCCCTACCTCATCCATCCAGG - Intergenic
1108389926 13:49937132-49937154 CAGACTTCCCGCAGCCTCCTGGG - Intergenic
1111223809 13:85242977-85242999 CTGACTGACCTAAGACACCCTGG + Intergenic
1112559685 13:100501796-100501818 CAGCCCAACCTCCGCCACCCGGG - Intronic
1115657187 14:35455081-35455103 GAGTCTCACCTCAGCCACCCAGG + Intergenic
1117816957 14:59608571-59608593 CAGACTTACCTCAGGCTGGCTGG + Intronic
1118326966 14:64787802-64787824 CAGACTGACCCCAGGCCCCCAGG - Intronic
1118868545 14:69722389-69722411 CTGTCTTGCCTCAGCCTCCCAGG - Intergenic
1121361847 14:93268782-93268804 CAGATTTTGCTCAGCCGCCCAGG + Intronic
1128114449 15:65096581-65096603 CAGGCTTGCCTCAGGCCCCCAGG + Intronic
1128308416 15:66615209-66615231 CAGATTTACCTAAGGCCCCCAGG + Intronic
1133085144 16:3356387-3356409 CAGAGTTGCCCAAGCCACCCAGG - Exonic
1134302757 16:13006230-13006252 CAGAGTGACCTCAGCAACCTGGG + Intronic
1136423415 16:30152117-30152139 CACACTAACCTCCGCCTCCCAGG + Intergenic
1136639893 16:31554720-31554742 CAGAGTCACCTAAGCCATCCTGG + Intergenic
1138800500 16:60021661-60021683 CAGACTTACCTTGGCCACTTGGG - Intergenic
1139415751 16:66807927-66807949 CAGTCTCACCACAGTCACCCAGG + Intronic
1140328666 16:74030551-74030573 CAGCCTTCCCTCCCCCACCCTGG - Intergenic
1141227608 16:82133769-82133791 CAGGCTCACCTCAGCCTCCTGGG + Intergenic
1143100755 17:4503489-4503511 CAGAGCCACCTCTGCCACCCAGG + Intronic
1143296276 17:5874337-5874359 GAGGCTTGCCTCGGCCACCCTGG + Intronic
1143635529 17:8162240-8162262 CACACTCACCTCATCCACCTGGG + Exonic
1145234378 17:21198434-21198456 CACACTCACCTCCTCCACCCCGG - Exonic
1146307644 17:31742818-31742840 CAGTCTCACCTCTGTCACCCAGG - Intergenic
1147536306 17:41324995-41325017 CTGATTTTTCTCAGCCACCCTGG + Intergenic
1147714772 17:42498140-42498162 CTGCCTTGCCTCAGCCTCCCAGG - Intronic
1147729924 17:42592842-42592864 CAGGCATGCCTCAGCCTCCCAGG - Intronic
1148364650 17:47045030-47045052 CAGCCTTACCTCTGCCACAAAGG - Intronic
1150257212 17:63757005-63757027 CAGTCATGCCTCAGCCTCCCAGG - Intronic
1153512845 18:5874162-5874184 CAGACTTACCTCAACTGCCAGGG - Intergenic
1158734526 18:60064477-60064499 CAGATTTACCCCAGGCACACTGG - Intergenic
1161766617 19:6212131-6212153 CAGACTCGCATCAGCCGCCCTGG - Intergenic
1162220258 19:9170549-9170571 CAGTGTTACCTCTGCCTCCCAGG + Intergenic
1163321487 19:16577351-16577373 CAGCGTGACCTCGGCCACCCAGG - Exonic
1163387146 19:17006784-17006806 CAGGATTGCCTCTGCCACCCCGG + Intronic
1165061794 19:33208396-33208418 CAGTCTGAGCTCGGCCACCCAGG - Exonic
1165071954 19:33260942-33260964 CAGACTTCCCGCTGCCCCCCCGG - Intergenic
1165139214 19:33689006-33689028 CAGGCTTCCCTCAGCCTCCTGGG + Intronic
1166287335 19:41839302-41839324 CAGACTGACCTCTAGCACCCAGG - Exonic
1166728474 19:45043720-45043742 CTTGCTTACCTCTGCCACCCAGG + Intronic
1167243497 19:48359530-48359552 CAGAGTTTCCTCAGTCGCCCAGG + Intronic
1167768931 19:51501751-51501773 CAGACTTACCTCAGCAACCCTGG - Exonic
1168593635 19:57656293-57656315 CAGACATCCCTCATACACCCAGG + Intergenic
925612663 2:5715670-5715692 CAGTGTAACCTCTGCCACCCAGG - Intergenic
931159506 2:59673384-59673406 AAGATTTACCCCATCCACCCAGG + Intergenic
932852435 2:75200134-75200156 GACACTTTCCTCAGCCACCCTGG + Intergenic
933727333 2:85434337-85434359 CAGGCCTACCACAGCCCCCCAGG + Intronic
934098012 2:88625631-88625653 CTGCCTAACCTCTGCCACCCAGG + Intronic
935050077 2:99517880-99517902 CACACTTCCCTCAGCCAGCCTGG + Intergenic
935856045 2:107275214-107275236 CATACTTACTGCAGCCACACAGG + Intergenic
935925915 2:108068211-108068233 CTGAGTAACCTCAGCTACCCTGG + Intergenic
937395359 2:121530179-121530201 CAGCCTTCCCTCGGCCTCCCCGG - Intronic
938227354 2:129627306-129627328 CACCCCTACCACAGCCACCCTGG - Intergenic
940712560 2:157179922-157179944 CAGACTTCTCTCAGCCATCCTGG + Intergenic
942019141 2:171849635-171849657 CTCACTGACCTCAGCCTCCCGGG + Intronic
944373426 2:199012039-199012061 CAGGCTGACCTTAGCAACCCTGG - Intergenic
945958420 2:216107519-216107541 TTCACTTACCTCAGCCTCCCAGG - Exonic
947061447 2:226171150-226171172 CAGACTCAGCTCAGCCACTGTGG - Intergenic
947415068 2:229886572-229886594 CTGCCTCACCTCAGCCTCCCGGG + Intronic
947910676 2:233798897-233798919 CAGACTTCCCTTTGCCTCCCTGG - Intronic
948849849 2:240700185-240700207 CAGACACACCTCCGGCACCCAGG - Intergenic
949066729 2:241995536-241995558 CAGGCTTACCTGGGCCACGCGGG + Intergenic
1169461957 20:5803268-5803290 CAGACCTACCTCAGCCTCCCAGG + Intronic
1172675683 20:36669703-36669725 CGGACCTGCCTCAGCCTCCCAGG + Intronic
1173961626 20:47077058-47077080 CAGCCTCACCTCAACCACCAGGG + Intronic
1174003711 20:47393557-47393579 CAGACTAACCCCACCCATCCTGG + Intergenic
1175473960 20:59255900-59255922 CAGATCTACGTCAGCCAGCCCGG + Exonic
1176057041 20:63154496-63154518 TGGACTGGCCTCAGCCACCCCGG + Intergenic
1178592657 21:33924495-33924517 CAGACTTCCCATAGCAACCCAGG + Intergenic
1179513913 21:41893257-41893279 AACACTTACCTCAGCCTCCCAGG - Intronic
1182123289 22:27800236-27800258 CAGCCTCACCACGGCCACCCGGG - Exonic
1182845928 22:33430907-33430929 CAGACTGGCCTCAGCCTCCAGGG + Intronic
1183383800 22:37503636-37503658 CATACTGACCACAGCCTCCCAGG + Intronic
1183459562 22:37941667-37941689 TAGGCTTTCCTCTGCCACCCCGG + Exonic
1184849843 22:47113859-47113881 CAGACCTAGCTCAGGTACCCTGG - Intronic
1185246598 22:49776272-49776294 CAGGCCTTTCTCAGCCACCCCGG + Intronic
1185394397 22:50579321-50579343 CAGGCTGCCCACAGCCACCCGGG + Intronic
1185395930 22:50588224-50588246 CAGGCTTCATTCAGCCACCCAGG - Intronic
949533987 3:4981260-4981282 CAGACTTAAAACAGCCAACCAGG + Intronic
950222357 3:11206020-11206042 CAGACAGACCTCAGACATCCAGG - Intronic
950404128 3:12794079-12794101 CAGGCTCACCTCTGCCTCCCAGG + Intergenic
952138082 3:30446166-30446188 CAGACTTTCCACAGTCACTCAGG + Intergenic
952191256 3:31025703-31025725 CACCCTGACCTCAGCCACACTGG + Intergenic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
956625101 3:71259116-71259138 CAGTCTTAGCTCTGTCACCCAGG - Intronic
961033977 3:123629553-123629575 CAACGTTACCTCAGCCACCTGGG - Exonic
963222787 3:142829143-142829165 CATACATGCCTCAGCCCCCCAGG + Intronic
966868644 3:184276278-184276300 CAGCCTTACCTCCGCGAGCCGGG - Intronic
967778286 3:193407304-193407326 CACACTTACCTCGGCCACAAGGG + Exonic
968295792 3:197575574-197575596 CAGACCTCCCTCAGCCAGGCTGG - Intergenic
968794018 4:2690036-2690058 CAGCCAGACCTCAGCCCCCCCGG + Intronic
968929900 4:3573337-3573359 CGGACCTTCCTCAGCCTCCCAGG + Intergenic
969315960 4:6381448-6381470 CACACCTACCCCTGCCACCCAGG + Intronic
969843502 4:9901130-9901152 CAGACTGAGCTCAGGCCCCCAGG + Intronic
970440975 4:16080981-16081003 GCCACTTACCTAAGCCACCCAGG + Intronic
970656123 4:18231896-18231918 CAGAATTACCTAAGCCAAACTGG - Intergenic
970993752 4:22241503-22241525 CAGACTTACTTCAGCTTCCATGG - Intergenic
979277150 4:118827204-118827226 CAGTCTGACCCCAGCCAACCTGG - Intronic
979647997 4:123094295-123094317 CAGACTTCACTATGCCACCCCGG - Intronic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
985168013 4:187117954-187117976 CATCCTTACCTCTTCCACCCTGG - Intergenic
985774629 5:1834317-1834339 CAGAATCACCTCTGCCACCGTGG - Intergenic
985851482 5:2391787-2391809 CAGACCTAACTCCGCCGCCCTGG - Intergenic
986031340 5:3895713-3895735 CACACCTGCCTCAGCCATCCAGG - Intergenic
986637308 5:9835835-9835857 CAGTTTTAACTCAGCCACCCTGG - Intergenic
986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG + Intergenic
986899435 5:12413408-12413430 CAGCATTACCTTAGCAACCCTGG + Intergenic
987137412 5:14912886-14912908 CTCACTGACCTCAGCCTCCCAGG + Intergenic
988829598 5:34974401-34974423 CAGAGTTTCCTCTGTCACCCAGG - Intergenic
990347785 5:54886225-54886247 CAGACTTACCTCAGTGGCCCAGG + Intergenic
990883147 5:60562811-60562833 CAGACTTGACTCTGACACCCTGG + Intergenic
997676949 5:135720228-135720250 CTGTCTTACCTCAGCTGCCCTGG - Intergenic
999335989 5:150717273-150717295 GAGTCTCACCTCAGCCGCCCAGG + Intronic
999642222 5:153683074-153683096 CAATCTGACCTCAGACACCCTGG + Intronic
1000057271 5:157618547-157618569 CAGACCTCGCTCAGCCACGCTGG + Intergenic
1000296005 5:159914192-159914214 CAGACTAGTCTGAGCCACCCAGG + Intergenic
1003183192 6:3809334-3809356 CAGACATCCCTCAGCATCCCAGG + Intergenic
1004781639 6:18914902-18914924 AAGACTAAAGTCAGCCACCCGGG - Intergenic
1005017131 6:21385082-21385104 CAGAGTCAGCTCTGCCACCCTGG - Intergenic
1006077928 6:31546298-31546320 CAGCCTTCTCTCAGCCAACCAGG + Intronic
1006745247 6:36337034-36337056 GAGGCTTAGCTCAGCTACCCTGG + Intergenic
1007585575 6:42986980-42987002 CAGACAAACCTCAGTCACACTGG - Intronic
1007927488 6:45662217-45662239 CTGAGCTATCTCAGCCACCCTGG - Intronic
1010147271 6:72684489-72684511 TAGACTTGCCTCTGCCACCTGGG + Intronic
1011558958 6:88596061-88596083 CAAACTTGCCTAAGCCAACCAGG - Intergenic
1014581458 6:123142432-123142454 CAGACATTCCCCAGCCAGCCTGG + Intergenic
1017543735 6:155428903-155428925 CACCCTTACCTCTGCCCCCCAGG - Exonic
1017577510 6:155821522-155821544 GTGACTTAGCTCAGCCACCCTGG - Intergenic
1018080873 6:160258575-160258597 CAGACTCAGCTCGGCCACTCCGG + Exonic
1018697118 6:166398873-166398895 TAGACCTGCTTCAGCCACCCTGG - Intergenic
1019431226 7:1000775-1000797 CACTCTTACCTTGGCCACCCCGG + Intronic
1019800781 7:3086865-3086887 CAGACTAAACTCAGCCAGCGAGG - Intergenic
1019818378 7:3218215-3218237 AAGTGTTACCTCAGCCTCCCTGG - Intergenic
1020039631 7:4992182-4992204 CTGCCTTACCCCAGCCACACAGG - Intronic
1022385325 7:29893453-29893475 CAGACCTACTTCACGCACCCCGG - Intronic
1022648668 7:32255153-32255175 CAAAGTGACGTCAGCCACCCTGG - Intronic
1022723813 7:32963305-32963327 AACACCTAGCTCAGCCACCCAGG - Intronic
1023351004 7:39320204-39320226 CAGAGTTCCCTCAACCACCGTGG + Intronic
1023522400 7:41061375-41061397 CAGACTCCCCTCAGCATCCCTGG - Intergenic
1024329219 7:48139751-48139773 CAGATTTTGCTCAGCCAGCCAGG - Intergenic
1024629002 7:51231929-51231951 AAGTCTAACCACAGCCACCCAGG + Intronic
1025049812 7:55724611-55724633 AACACCTAGCTCAGCCACCCAGG + Intergenic
1026013470 7:66654566-66654588 CAGACCTACTGCAGCCACGCGGG + Intronic
1028850148 7:95528575-95528597 CAGACTTACCTCAGTCCCTCAGG - Intronic
1029715759 7:102324586-102324608 CAGACCCACCACAGCCTCCCTGG - Intergenic
1029884126 7:103849006-103849028 CAGACTTCCCACAGCCTACCAGG + Intronic
1032519607 7:132534005-132534027 CAGCCTTCACTCAGCCACCAAGG - Intronic
1034269139 7:149795238-149795260 CAGACTCCCCTCAGCCAGTCCGG - Intergenic
1034701395 7:153099305-153099327 CACACAGACCTCAGCCACCATGG + Intergenic
1034701408 7:153099373-153099395 CACACAGACCTCAGCCACCATGG + Intergenic
1036618583 8:10407277-10407299 CAGACTTTCATCAGCTCCCCTGG + Intronic
1037585834 8:20275447-20275469 CAGCCTTACTTCCCCCACCCGGG + Intronic
1038613782 8:29075272-29075294 CAGACTCACCTCCTCCATCCTGG + Exonic
1039527891 8:38232131-38232153 CAGACTTACCTCAGCCACCCTGG - Intronic
1044552765 8:93530255-93530277 CAGGTTTACCTCAGCTTCCCAGG - Intergenic
1047341984 8:123990240-123990262 CAGAGTCTCCTCTGCCACCCAGG - Intronic
1047957620 8:129987431-129987453 GGGACTTAGCTCAGCCTCCCAGG - Intronic
1051370194 9:16352732-16352754 CAGACTAACCTGAGGCTCCCAGG + Intergenic
1054460379 9:65459134-65459156 CAGACCTTCCGCAGCCTCCCAGG - Intergenic
1056033439 9:82578927-82578949 CAGAGTTTCCTCTGTCACCCAGG + Intergenic
1058197236 9:101992671-101992693 CAGAATCACTTCAGCCACACTGG + Intergenic
1058709636 9:107668027-107668049 CAGACTTAACGCAGTCACCTTGG - Intergenic
1060445068 9:123680237-123680259 CAGAGTTACCTGAGCCACAGTGG - Intronic
1186526579 X:10254671-10254693 CAGATGTATCTCAGCCTCCCTGG - Intergenic
1188826094 X:34837527-34837549 CAAAGTGACCTCCGCCACCCAGG + Intergenic
1188846361 X:35076988-35077010 CAGAACTCCCTTAGCCACCCTGG + Intergenic
1190477176 X:50839909-50839931 CAGGCTTCCCTTGGCCACCCAGG + Intergenic
1190537840 X:51447098-51447120 CAGAACTCCCTTAGCCACCCTGG + Intergenic
1194416567 X:93619379-93619401 AAGACATACCTCAGCCTTCCTGG + Intergenic
1195038897 X:100995503-100995525 CAGAGCCACCTCAGCCTCCCTGG - Intergenic
1195129725 X:101840434-101840456 CAGACACAGCTCAGTCACCCAGG + Intronic
1195176513 X:102319389-102319411 CAGACACAGCTCAGTCACCCAGG - Intronic
1195182351 X:102367704-102367726 CAGACACAGCTCAGTCACCCAGG + Intronic
1195202380 X:102564089-102564111 CAGACACAGCTCAGTCACCCAGG - Intergenic
1197661601 X:129179446-129179468 CAGAATCCCCTTAGCCACCCTGG + Intergenic