ID: 1039532276

View in Genome Browser
Species Human (GRCh38)
Location 8:38273843-38273865
Sequence CAGAATTAATTGCTGGAGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039532270_1039532276 21 Left 1039532270 8:38273799-38273821 CCATATCTAATCAACAGAAGTAC 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1039532276 8:38273843-38273865 CAGAATTAATTGCTGGAGTCAGG 0: 1
1: 0
2: 1
3: 24
4: 164
1039532272_1039532276 -8 Left 1039532272 8:38273828-38273850 CCCAATGAGTCACCGCAGAATTA 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1039532276 8:38273843-38273865 CAGAATTAATTGCTGGAGTCAGG 0: 1
1: 0
2: 1
3: 24
4: 164
1039532273_1039532276 -9 Left 1039532273 8:38273829-38273851 CCAATGAGTCACCGCAGAATTAA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1039532276 8:38273843-38273865 CAGAATTAATTGCTGGAGTCAGG 0: 1
1: 0
2: 1
3: 24
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039532276 Original CRISPR CAGAATTAATTGCTGGAGTC AGG Exonic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
903583591 1:24391044-24391066 GAGAATTAATTGCTTGAGCCAGG - Intronic
904319973 1:29690247-29690269 GAGAATTAAGAGCTGGAGTGAGG - Intergenic
904524387 1:31121732-31121754 AAGAATTAATTGCTTGAACCTGG + Intergenic
904531791 1:31174821-31174843 CAGCATGAACTGCAGGAGTCAGG - Intergenic
906539783 1:46576476-46576498 GAGAGCTAAATGCTGGAGTCAGG + Intronic
908283945 1:62572849-62572871 CACAATTAAGTGTTGGAGCCAGG + Intronic
908333462 1:63095943-63095965 CAGAATTTATTTCTGAAGGCAGG - Intergenic
908342665 1:63197772-63197794 CAGAATTAATATTTGGACTCTGG - Intergenic
912401926 1:109400807-109400829 CATAATTATTTGCTGGGCTCTGG - Exonic
913597251 1:120390175-120390197 CATCATTAATTGCTGGGGTCAGG + Intergenic
914090077 1:144489131-144489153 CATCATTAATTGCTGGGGTCAGG - Intergenic
914308534 1:146445091-146445113 CATCATTAATTGCTGGGGTCAGG + Intergenic
914377312 1:147083794-147083816 CATCATTGATTGCTGGGGTCAGG - Intergenic
914511185 1:148333825-148333847 CATCATTAATTGCTGGGGCCAGG - Intergenic
914514222 1:148360423-148360445 CATCATTAATTGCTGGGGTCAGG - Intergenic
914593574 1:149128042-149128064 CATCATTAATTGCTGGGGTCAGG - Intergenic
914697476 1:150098143-150098165 CAGAAATAATTACTGTAGGCAGG - Intronic
916152983 1:161814178-161814200 CAGAAATACTTGATGGAGGCCGG - Intronic
916191617 1:162184606-162184628 AAGAGTAAAGTGCTGGAGTCAGG - Intronic
918550409 1:185735181-185735203 AAGAATTACTTGCTGGCGTCTGG + Intronic
922180954 1:223232252-223232274 CAGTATTATTAACTGGAGTCTGG - Intronic
922192577 1:223332626-223332648 CAGAATTACTTGCTACAGTGTGG - Intronic
924795077 1:247287161-247287183 CGGAAATAATTGCTTAAGTCAGG - Intergenic
1064441026 10:15353868-15353890 CAGAATGGAGTGTTGGAGTCAGG - Intronic
1065184959 10:23162779-23162801 CATAAATAATTGCTGGATGCAGG - Intergenic
1065565200 10:27001237-27001259 CAGAGTTAGGGGCTGGAGTCTGG + Intronic
1067790820 10:49286385-49286407 CTGAACCAAATGCTGGAGTCAGG + Intergenic
1069548865 10:69348512-69348534 CAGAATTAATTCATTGAGGCTGG + Intronic
1070398918 10:76035847-76035869 AAGAATTAGTAGCAGGAGTCGGG - Intronic
1072453326 10:95556461-95556483 CAGAAAGAATTGCTTGAGCCTGG - Intronic
1074341065 10:112630581-112630603 TAGTATTAAGTGGTGGAGTCAGG + Intronic
1074900861 10:117815531-117815553 AAGAATGAGTTCCTGGAGTCAGG - Intergenic
1075604917 10:123797810-123797832 CAGAATCAATCACTTGAGTCTGG - Intronic
1075953985 10:126506579-126506601 CAGAATCAATCTCTGGGGTCTGG - Intronic
1077476086 11:2791279-2791301 CAGCATCAATTGCGGGAGTCCGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080396613 11:31895618-31895640 CAGAACTAATTCCTTGACTCTGG + Intronic
1080675341 11:34421236-34421258 CAGCATGAATTGCTGGACCCAGG - Intergenic
1081112805 11:39157622-39157644 CAGAAATAATTACTGGAATAGGG - Intergenic
1082818016 11:57523263-57523285 AAGGATTCATTGCTGGAGTCAGG - Intergenic
1084294712 11:68204707-68204729 CAGGAGAAATTGCTGGAATCTGG - Intronic
1087338655 11:96875245-96875267 AAGCAATGATTGCTGGAGTCAGG - Intergenic
1089582819 11:119492134-119492156 CAGAATCAATTGATGGAGAGAGG + Intergenic
1090337490 11:125982397-125982419 CAGGATTTGTTGTTGGAGTCTGG + Intronic
1090382011 11:126333989-126334011 CAGAATTAATTGGTGGAGTGGGG + Intronic
1090420652 11:126572889-126572911 AAGAATTGATCACTGGAGTCAGG + Intronic
1090631181 11:128650132-128650154 CAGAATTACATGCTGGATTAAGG - Intergenic
1093724545 12:22488963-22488985 AAGAATTGATTGCTTGAGCCTGG - Intronic
1102639406 12:114353560-114353582 CTGAATTAATTGTTGGAGCCAGG - Intergenic
1102733187 12:115132725-115132747 CAAAATCAATTGCTGGAAACTGG + Intergenic
1106022681 13:25930130-25930152 CAGCATTAAATGCTGCAGGCAGG - Intronic
1106853907 13:33826928-33826950 CATAATTAATTGCTGGATTTTGG + Intronic
1110809349 13:79794397-79794419 CAGACTTAATTGTTTGAGTTTGG + Intergenic
1112397248 13:99044257-99044279 CAGAATCAATTACAGGAGGCTGG - Intronic
1115722842 14:36181954-36181976 CAAAATTAAATGCTGGGGTGGGG - Intergenic
1116986837 14:51229160-51229182 CAGAATTAAATTATGAAGTCTGG - Intergenic
1118229878 14:63937940-63937962 CTGAAATGATTGCTGGAGTTGGG + Intronic
1119201861 14:72759370-72759392 TAGAAATAATGGCTGGAGGCTGG + Intronic
1120045926 14:79806104-79806126 TAGAATTAATAGCTGGAGTTGGG + Intronic
1120898732 14:89557599-89557621 CAGAATTGCTTGCTGGGGTGTGG + Intronic
1126165255 15:45649567-45649589 GAGAATCAATTGCTTGAGCCAGG - Intronic
1128467859 15:67927953-67927975 CAGAGATAAGTGCTGGAGTTTGG + Intergenic
1135264587 16:21012008-21012030 CAGTATTAAGTGTTGGAGCCAGG + Intronic
1135604706 16:23813377-23813399 GAGAATTAATTGCTGAAGCAAGG - Intergenic
1135975860 16:27108718-27108740 GAGAATTAATTGCTTGAACCCGG + Intergenic
1139291945 16:65867403-65867425 CTGAATTAAGTGCTGTTGTCTGG + Intergenic
1143429312 17:6868294-6868316 CAGAATTAATTACATTAGTCAGG + Intergenic
1147493799 17:40896471-40896493 CAAAAATAATTGCATGAGTCAGG + Intergenic
1149813298 17:59698928-59698950 TAGAATTAATTGCTGGATGATGG + Exonic
1150995426 17:70311864-70311886 CACAGCTCATTGCTGGAGTCTGG + Intergenic
1157566578 18:48682747-48682769 CAGGAGCAGTTGCTGGAGTCTGG - Intronic
1157843679 18:50982616-50982638 CTGAATTTATTGCTGGAATATGG - Intronic
1160694062 19:474151-474173 CACAATTAGCGGCTGGAGTCAGG - Intronic
1162820029 19:13217289-13217311 CACCATTCATTGCTGGAGACTGG - Intronic
1164606475 19:29602381-29602403 CATAATAAATTGCTGGAGGTCGG + Intergenic
1166846086 19:45729610-45729632 CAGCATTAATTGCTAGACTCAGG - Intronic
1168282884 19:55315017-55315039 CAGAATTAATCACTGTAGGCTGG + Intronic
925380209 2:3419479-3419501 CTGTATTACTTGCTGTAGTCTGG + Intronic
926471766 2:13268931-13268953 CTGAAATGATGGCTGGAGTCAGG + Intergenic
926924221 2:17970374-17970396 CAGCATTAAGTGGTGGAGACAGG - Intronic
927587848 2:24324758-24324780 CAGAAGGAATTGCTTGAGCCTGG + Intronic
929239507 2:39639549-39639571 CAGAAGTAAGTCCTGGAGACAGG + Intergenic
930149688 2:48045837-48045859 CAGAAATAACTTCTGTAGTCTGG - Intergenic
932017294 2:68044072-68044094 CAGTTTTAAATGCTGAAGTCAGG - Intronic
933318757 2:80745939-80745961 CAGGATGAATTGCTTGAATCTGG + Intergenic
939268011 2:139900555-139900577 CAGAATTTAATACAGGAGTCTGG - Intergenic
941677280 2:168357200-168357222 CAGAATCATTTGCTGCAGTTTGG - Intergenic
942342097 2:174959484-174959506 CAGAATTAGTTGCTGAAGGCAGG + Intronic
942528730 2:176885373-176885395 CAGATTTCATGGCTGGAGTATGG - Intergenic
946767007 2:223050232-223050254 CAGGACTAATTGCAGGAGTCAGG - Intergenic
947112341 2:226732104-226732126 CATAATTAATTCCTCGAGTAGGG + Exonic
1170280762 20:14645433-14645455 CAGAATTGACTTCTGGAGACTGG + Intronic
1170355094 20:15483578-15483600 CAAAATAACTTGCTGGAATCTGG + Intronic
1174776080 20:53344167-53344189 AAGAATTTTTTGCTGGAATCTGG - Intronic
1174949842 20:55031428-55031450 CAGAATTAATTGCTCTAATTAGG - Intergenic
1176369938 21:6056617-6056639 CAGGCCTAATTTCTGGAGTCTGG - Intergenic
1177545489 21:22552735-22552757 TAGAGTTAATTTCTGGAGACTGG + Intergenic
1177938454 21:27379536-27379558 AAGAAGTAATTGTTGAAGTCGGG + Intergenic
1179287767 21:39992753-39992775 GAGGAATAATTGCTGGAGACTGG - Intergenic
1179344375 21:40543290-40543312 TATAATTGATTGCTGGAATCAGG - Intronic
1179753581 21:43481924-43481946 CAGGCCTAATTTCTGGAGTCTGG + Intergenic
1183683523 22:39349273-39349295 CGTAATTAATTGCTAGATTCAGG + Intergenic
1184147123 22:42618240-42618262 CAGAAATAAATGCTGGAGCCGGG + Exonic
949561669 3:5208306-5208328 AAGAATGAACTGCTGGGGTCAGG - Intronic
953099464 3:39810332-39810354 CAGAATTAAGAGTTTGAGTCAGG - Intronic
955444556 3:58995733-58995755 CAGAATAAAATGGTGGAGTAAGG + Intronic
955469912 3:59275649-59275671 CAGAATTAATTGCAGCAGACTGG + Intergenic
958268907 3:91473734-91473756 CAGAATCAAGTTCTGGGGTCAGG - Intergenic
966717807 3:183031124-183031146 CAGAAGTTATTGGTGGAGTCAGG - Intronic
966864938 3:184252851-184252873 GAGAATTAATTGCTTGAACCAGG + Intronic
973111374 4:46402255-46402277 AAGAATTACATGCTGGATTCTGG + Intronic
973666077 4:53160648-53160670 TAGAATTAATTGAAGGATTCTGG + Intronic
974166656 4:58213192-58213214 AAGAATTACTTGCTGGGTTCTGG - Intergenic
974821785 4:67075899-67075921 AAAAATTTATTTCTGGAGTCTGG - Intergenic
974887291 4:67835215-67835237 CAGAATTACTTGTTGGGGTTGGG + Intronic
975597091 4:76058341-76058363 CTGAATGAATTGCTTGAGTTTGG + Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
978145894 4:105371665-105371687 CAGACTTAAATGCTAGAGGCAGG - Intronic
978422498 4:108547455-108547477 CAGGAAGAATTGCTTGAGTCTGG + Intergenic
978756991 4:112313424-112313446 AAGAATTGACTGCTGGAGGCCGG + Intronic
980027544 4:127783398-127783420 CAGAGTGAATTGCCGGAGTCGGG + Intronic
981325138 4:143437734-143437756 CAGATTTAATAGGTGGAGTTGGG + Intronic
981343726 4:143651506-143651528 CGGAACAAAATGCTGGAGTCTGG + Intronic
982522750 4:156439933-156439955 AAGAAGTAAATGCTGGAGGCTGG + Intergenic
984211028 4:176848628-176848650 CAGACTTAATGGCTGGAAACAGG + Intergenic
984570900 4:181392354-181392376 AACAAATAATTGCTGGAGGCTGG - Intergenic
985857109 5:2437165-2437187 CAGAATTTATAGCTGGTGTTAGG + Intergenic
988055972 5:26097244-26097266 CAGAAAAGTTTGCTGGAGTCTGG - Intergenic
990460812 5:56029344-56029366 CAGAATGCATTCCTGGACTCTGG - Intergenic
991357066 5:65779830-65779852 CAGAAGTACTTCCTGGAGTTTGG + Intronic
991992092 5:72349908-72349930 CAGAAATAGTTGCTGGAGGGAGG + Intronic
993886586 5:93422320-93422342 CAGATCCAATTGCTGGAGTCGGG - Intergenic
994348162 5:98713101-98713123 CAGAATTACTTGCTTGACTGAGG + Intergenic
996073886 5:119165948-119165970 ATGAATTAAATGGTGGAGTCTGG + Intronic
997546357 5:134711451-134711473 GAGGATTGATTGCTTGAGTCTGG + Intronic
997610856 5:135214851-135214873 TAGAATTAAATGCTAGAGTGGGG + Intronic
999319900 5:150607652-150607674 CAGAATGCAGTGCTGGAGTATGG + Intronic
1000580665 5:163031890-163031912 CAGAATTAATTGCTTGCTGCTGG + Intergenic
1000776955 5:165431811-165431833 CAGAAGTAATTTCTGGAATTTGG - Intergenic
1000780791 5:165478247-165478269 CAAAATTATTTGCAGGTGTCGGG - Intergenic
1001234360 5:170017024-170017046 GAGAATGAAATGGTGGAGTCAGG - Intronic
1002910447 6:1487327-1487349 CTGCATTCAGTGCTGGAGTCGGG + Intergenic
1003942178 6:11040856-11040878 CACAGTTAAATGCTGGTGTCAGG + Intronic
1004597875 6:17117767-17117789 CAGAATTGCTTGCTTGAATCTGG - Intronic
1005073717 6:21886906-21886928 CAGCAATACTTGCTGGAATCTGG + Intergenic
1006210530 6:32389938-32389960 AAGAATTAATTGATGTAGCCAGG - Intergenic
1006250196 6:32777152-32777174 CAAAATTTATTTCTGGAGGCTGG + Intergenic
1008032337 6:46711075-46711097 CAAAATTAAGTGGTGGAGCCAGG + Intronic
1008986321 6:57547988-57548010 CAGAATCAAGTTCTGGGGTCAGG + Intronic
1009174285 6:60440565-60440587 CAGAATCAAGTTCTGGGGTCAGG + Intergenic
1012484963 6:99710989-99711011 TAGAAGTAAATGCTGGAGGCCGG - Intergenic
1015256398 6:131183753-131183775 TAGGATTCTTTGCTGGAGTCAGG - Intronic
1015720334 6:136234978-136235000 GAGAATTAATTGTTTGAGCCCGG - Intronic
1017619857 6:156285484-156285506 TAAAATTATTTGCTGGAGTGAGG - Intergenic
1018222381 6:161593853-161593875 TAGAATTGACTGCTGGAGGCCGG + Intronic
1020926227 7:14329281-14329303 CAGAATCAAGTGCTAGAGTGTGG + Intronic
1022702107 7:32771264-32771286 CAGTATTAAATGATGTAGTCTGG - Intergenic
1026293407 7:69029150-69029172 CAGAACCAATTGCTGTTGTCAGG - Intergenic
1028952573 7:96653505-96653527 CAGAAGTAATTGTTGTAGCCAGG + Intronic
1029101493 7:98134517-98134539 CAGAAATAATTCCAGCAGTCTGG + Intronic
1031957142 7:127954166-127954188 CAGAAATATTTGCTGGAGTAAGG - Intronic
1033668707 7:143468849-143468871 GAGAATTAATTGCTTGAACCTGG - Intergenic
1034170956 7:149062657-149062679 GAGAATTAATTGCTTGAATCCGG - Intergenic
1037881682 8:22576596-22576618 CATTATTAAATGCTGAAGTCAGG + Intergenic
1039532276 8:38273843-38273865 CAGAATTAATTGCTGGAGTCAGG + Exonic
1039705261 8:39999914-39999936 AGGAATTGATTGCTGGGGTCAGG + Intronic
1042416805 8:68529112-68529134 AACAATTAATTGCTGGGGCCAGG - Intronic
1044437223 8:92178562-92178584 GAGGATCAATTGCTTGAGTCTGG - Intergenic
1045203262 8:100009323-100009345 CAGAAGTAATTGCTTGAACCCGG + Intronic
1046101643 8:109621276-109621298 AAGGATTAAGTGCTGGGGTCTGG + Intronic
1048328540 8:133456618-133456640 CAGAATTAAATGCACCAGTCTGG - Exonic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1050199691 9:3131128-3131150 AAGACGTAAGTGCTGGAGTCAGG + Intergenic
1055596074 9:77865560-77865582 CAAATTTAATTGCTGGAGAGAGG + Intronic
1056422442 9:86442033-86442055 CCAAATCAATGGCTGGAGTCAGG - Intergenic
1057720213 9:97526304-97526326 CAGAATTCATCCCTGCAGTCAGG + Intronic
1059852378 9:118357931-118357953 GAAAATTAATTGCTAGAGTGTGG - Intergenic
1059875674 9:118631881-118631903 CTGGATTTATTGCTGGAGTCTGG - Intergenic
1061402875 9:130378015-130378037 CAGAATTGAGTGGTGGAGCCTGG + Intronic
1061491375 9:130946523-130946545 GAGAATTAATTGCTTGAACCTGG + Intergenic
1188093524 X:25992855-25992877 TAAAATTAATTGCTGGATTATGG + Intergenic
1188173208 X:26954598-26954620 CAGAATTATTTGGTGTTGTCAGG - Intergenic
1194455045 X:94093363-94093385 CAGAATTGATTGCTGCTATCTGG - Intergenic
1195684300 X:107571652-107571674 CAGAATTACTGACTGGAGGCTGG - Intronic
1196849060 X:119920163-119920185 GAGGATTAGTTGCTGGAGTGGGG + Intronic
1197057500 X:122138504-122138526 CAGAACAAATTGATGAAGTCTGG + Intergenic
1197466799 X:126814667-126814689 CAGATTTAATTGCTGGGCCCAGG - Intergenic
1198657152 X:138926860-138926882 CAGAAAGAATTGCTTGAATCCGG + Intronic
1200217897 X:154376581-154376603 ATGAATTAATTGCTGTACTCAGG + Intergenic