ID: 1039532452

View in Genome Browser
Species Human (GRCh38)
Location 8:38275754-38275776
Sequence CTTCCAGTGCAGAGGGAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039532448_1039532452 -5 Left 1039532448 8:38275736-38275758 CCGAGCAGCAGAGGCGGCCTTCC 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG 0: 1
1: 0
2: 3
3: 18
4: 222
1039532445_1039532452 10 Left 1039532445 8:38275721-38275743 CCATGGGGTCATGTTCCGAGCAG 0: 1
1: 0
2: 1
3: 3
4: 67
Right 1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG 0: 1
1: 0
2: 3
3: 18
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039532452 Original CRISPR CTTCCAGTGCAGAGGGAACC AGG Exonic
901415516 1:9113478-9113500 CTTCCAGAACAGAGGGGCCCTGG + Intronic
901659218 1:10788319-10788341 CTCCCAGTGCAGAGGCAGGCAGG + Intronic
901777627 1:11571113-11571135 CAGCCAGTGCAGAGAGAACTGGG + Intergenic
903393499 1:22981852-22981874 CTTACAGTGCTGAGGACACCTGG + Intergenic
904774593 1:32899008-32899030 CTCTCAGTGCAGGGGGAACCTGG + Intronic
905640161 1:39583785-39583807 CACCCAGAGCAGAGAGAACCTGG - Intergenic
906085480 1:43129695-43129717 CTTCCGAGGCAGAGGGACCCAGG - Intergenic
906291251 1:44620731-44620753 ATCCCAGTGCAGAGGCCACCAGG - Intronic
908514524 1:64878975-64878997 CCCTCAGTGCAGAGGGAGCCAGG + Intronic
908715176 1:67062214-67062236 ATTCCAGTGCTTAGGGAAACAGG - Intergenic
910457794 1:87416185-87416207 CTTTCAGGGCAGAGGAAACAAGG - Intergenic
912778206 1:112520276-112520298 CCTGCAGTGCCTAGGGAACCTGG - Exonic
914224364 1:145707867-145707889 AATCCAGGGCAGAGGGAAGCAGG - Intronic
915240276 1:154516292-154516314 CATCCAGTGGAGAGGGAAACAGG + Intronic
916397195 1:164403799-164403821 CTTCCAGTTCAGAGCTAACTTGG + Intergenic
917688665 1:177444893-177444915 TTTCTAGTTCAGAGAGAACCAGG + Intergenic
918767192 1:188501338-188501360 CTCAGAGTGCTGAGGGAACCAGG - Intergenic
921807094 1:219467531-219467553 CTTCCCGTGCAATGGAAACCAGG - Intergenic
922619212 1:226980132-226980154 CCTCCAGTCCAGAGGGTGCCAGG - Intronic
922868913 1:228884229-228884251 CTTTCAGTGGAGAGGGGACATGG - Intergenic
922873431 1:228921200-228921222 TTTTCAGTGCAGAGGCAGCCAGG + Intergenic
923002184 1:230016209-230016231 CTTGCAGTGCATAGGAAAGCTGG + Intergenic
1063918618 10:10909514-10909536 CTACCAGGGCAGAAGGAACACGG - Intergenic
1065247778 10:23776156-23776178 ATTCAAGTTCAGAGGAAACCAGG - Intronic
1067004654 10:42649370-42649392 CTTCAAGTGCTGTGGGAAGCTGG + Intergenic
1070387496 10:75939162-75939184 CTTCCAGTGGTGAGGGGCCCTGG + Intronic
1070916582 10:80158914-80158936 GTTCAACTGCACAGGGAACCGGG + Intronic
1070931815 10:80266198-80266220 CCTCCAGAGCAGCGGGAACCAGG + Intergenic
1070963978 10:80518322-80518344 ATGCCAGTGGAGAGGGGACCAGG - Exonic
1072270387 10:93770525-93770547 CTCAGAGTTCAGAGGGAACCAGG - Intronic
1073958280 10:108897042-108897064 CATCTAGTGCCGTGGGAACCTGG - Intergenic
1074285994 10:112098813-112098835 CTTACTGTGCACAAGGAACCAGG + Intergenic
1075730306 10:124631792-124631814 CTGCCAGTGAAGAGGGAGACAGG - Intronic
1076632505 10:131859422-131859444 CCTCCAGTGGGGAGGGCACCAGG + Intergenic
1076730285 10:132435873-132435895 CATCCAGTGGAGAAGGCACCTGG - Intergenic
1076730393 10:132436225-132436247 CATCCAGTGGAGAAGGAGCCTGG - Intergenic
1076730472 10:132436486-132436508 CATCCAGTGGAGAAGGGACCTGG - Intergenic
1077026237 11:441266-441288 CTGCCAGTGAAGAGGTCACCTGG - Intronic
1081801495 11:45862794-45862816 CTCCCAGTGCAGTGAGAACTGGG + Intronic
1081805395 11:45887153-45887175 CTTCCACTGCAGAGGCCTCCAGG - Intronic
1084038321 11:66526882-66526904 CTCCCAGTGCACAGGGAGGCTGG - Intronic
1084636204 11:70394523-70394545 CTTAGAGTGCAGATGGGACCTGG - Intergenic
1085524622 11:77157121-77157143 TTTCCAGCACAGAGGGAAGCAGG - Intronic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1092003120 12:5047429-5047451 CTTCCAGTGACAAGGGAACAAGG - Intergenic
1095916245 12:47482172-47482194 TTTCCTGTGCAGAGGGCACTAGG - Intergenic
1096562702 12:52448069-52448091 TTTCCAGTGAAGAAGGCACCAGG + Intronic
1100270518 12:93020226-93020248 CTCCCTGTGCAGAGGTAGCCTGG - Intergenic
1101161599 12:101982540-101982562 CATTCAGTGCAGAGGAAAACCGG - Intronic
1101997555 12:109535747-109535769 CTTCCTCAGCACAGGGAACCCGG + Exonic
1103703950 12:122861511-122861533 ATCCCAGTGCAGACGGCACCTGG - Exonic
1103828755 12:123762309-123762331 CGCGCAGTGCAGAGGGAGCCGGG - Intergenic
1104339026 12:127930045-127930067 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1104997488 12:132667688-132667710 CTCCCAGAGCAGAGGGAGCCAGG + Intronic
1106305560 13:28506021-28506043 CTTCCTGGGCACAGGGCACCTGG - Intergenic
1107181786 13:37469829-37469851 CTGCCAGTGCAGCTGGAACAAGG + Intergenic
1107539989 13:41380286-41380308 CTTCCAGTTGAGAGGGAAAGGGG - Intergenic
1108478064 13:50841043-50841065 CTTCCAGAGCAGAGGACACGGGG + Intronic
1111278800 13:85990549-85990571 CTTTCAGTGAAGAGAGAACACGG + Intergenic
1118240035 14:64047168-64047190 CTCTCAGTGGAGAGGGAAGCTGG + Intronic
1118702097 14:68443407-68443429 CTTCCAGGGCAGAAGGAACCTGG + Intronic
1119174294 14:72557856-72557878 CCTCCAGTACAGGAGGAACCTGG - Intronic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119543345 14:75454973-75454995 CGTCCAGTGCAGAGGCGACGAGG + Intronic
1121950100 14:98164128-98164150 CCCCCAGGGCAGAGGGTACCAGG - Intergenic
1122886357 14:104712146-104712168 CTTCCAGGGCAGGTGGAGCCCGG - Intronic
1125926782 15:43569305-43569327 CATGCAGTGCACGGGGAACCTGG - Intronic
1125939926 15:43668870-43668892 CATGCAGTGCACGGGGAACCTGG - Intergenic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1127539177 15:59920241-59920263 CTTGCAGTTCTGAGCGAACCAGG + Intergenic
1127827467 15:62717695-62717717 GTTCCAGTGCACAGAGAGCCAGG + Intronic
1129686226 15:77687540-77687562 CTGCTAGGGCAGAGGGAATCTGG - Intronic
1131250499 15:90827181-90827203 CTTCGTGTGCAGTGGGAGCCTGG + Intergenic
1132376017 15:101328626-101328648 TTTCCACTGCAGAGAGACCCAGG - Intronic
1134136786 16:11681784-11681806 CTTCCTGTGCAGAGGCATCTTGG - Intronic
1134219452 16:12342223-12342245 CTTCCCTTGCAGAGGGCAACAGG - Intronic
1135085580 16:19472258-19472280 GGTCCAGGGCAGAGAGAACCAGG + Intronic
1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG + Intronic
1137396831 16:48122112-48122134 CTCCCAGTGCACATGGCACCTGG + Intronic
1138483298 16:57318394-57318416 CTTCCAGAGCAGAGGCAAGAGGG - Intergenic
1138576795 16:57912493-57912515 CTTCCAGTGGAGACGGGGCCTGG + Intronic
1138610670 16:58121302-58121324 CTTCCAGTTCAGAGGTCACTGGG + Intronic
1139847100 16:69929019-69929041 CATGCAGTGCAGAGGGTCCCAGG + Intronic
1140154287 16:72406628-72406650 CTTAAAGTGCTGAGGGAAGCAGG + Intergenic
1140550096 16:75856275-75856297 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1141068067 16:80929962-80929984 CATCCTCTACAGAGGGAACCTGG + Intergenic
1143123183 17:4622455-4622477 CTACCAGTCCAGAGGGGAGCAGG - Intergenic
1144945467 17:18967452-18967474 GTTCCAGGGCAGAGGGAATCTGG + Intronic
1146182150 17:30705408-30705430 CCTCCAGTGCACAGGGAACAAGG - Intergenic
1146186505 17:30727817-30727839 ATAGCAGCGCAGAGGGAACCAGG + Intergenic
1147726289 17:42567826-42567848 GTTCCAGAGCAGAGGGAACTAGG - Intronic
1147864110 17:43541761-43541783 CTTCCAGTACAGAGGCTGCCAGG - Intronic
1148458880 17:47826431-47826453 CCTCCAGTGCAGAAGTGACCTGG + Intronic
1148489646 17:48014751-48014773 ATTCGTGTGCAGAGGGAACAAGG - Intergenic
1148808263 17:50274944-50274966 CCTCCAGTGCTGGGGGACCCTGG + Intronic
1149296324 17:55265262-55265284 TTTCCAGTGCAGACGGTCCCAGG - Exonic
1149358194 17:55866075-55866097 CTTCAAATGCAGATGGCACCAGG + Intergenic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1153660688 18:7323259-7323281 CTTCCAGGGGAGAGGGAGCTGGG - Intergenic
1154005138 18:10520975-10520997 CTTCCAGCGCAGCAGGAAGCTGG - Intergenic
1156470497 18:37374709-37374731 CTTCCATGGGAGAAGGAACCGGG - Intronic
1156513917 18:37663808-37663830 CTTGCAGGGCTGAGGGAACAAGG - Intergenic
1157173513 18:45429872-45429894 CTTCAGGAGCAAAGGGAACCAGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159076264 18:63685108-63685130 CTTTCAGTGGAGAGGGAACATGG + Intronic
1160482926 18:79259647-79259669 CTTCCAGAGCAGACGGACCAGGG + Intronic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1162972337 19:14188240-14188262 ATAGCAGCGCAGAGGGAACCAGG - Intronic
1162976681 19:14210394-14210416 CCTCCAGTGCACAGGGAACAAGG + Intergenic
1164169212 19:22709485-22709507 CTCCCGGTGCAGAGGGAGGCTGG - Intergenic
1164640882 19:29824832-29824854 CTTCCAGCTCAGGGGGCACCAGG - Intergenic
1164692339 19:30220622-30220644 GTTCCAGAGGAGAGGGAACTTGG + Intergenic
1167701080 19:51046225-51046247 CTTCCAGTGCTGTGCCAACCTGG + Intergenic
925593694 2:5534763-5534785 ATTTCAGTTCAGAGGGAACTTGG - Intergenic
926347116 2:11957563-11957585 CTTGCAGTACAGAGGGAGGCTGG + Intergenic
927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG + Intergenic
927707268 2:25304149-25304171 CTTCCAGCGCAGAGGGGAGGGGG + Intronic
928252822 2:29696829-29696851 CTCCCAGAGCAGTGGGAAGCTGG - Intronic
929883973 2:45862356-45862378 GTTCCACTGGAGAGGGATCCAGG - Intronic
931218474 2:60267537-60267559 CTTCCAGTGAGAAGGGAACTTGG - Intergenic
933609786 2:84422053-84422075 CTTCCATGCCAGAGGGTACCTGG - Intergenic
933843879 2:86309570-86309592 CTTCCAGTGCTGTGGGAAAATGG - Intronic
934048708 2:88192121-88192143 ACTCCAGTGCAGAGGGACTCTGG + Intergenic
935175025 2:100642116-100642138 CTTCCAGGCCACAGGGGACCAGG - Intergenic
936295548 2:111264808-111264830 CTTGCAGTCCAGGGGGCACCCGG + Intergenic
938767738 2:134471825-134471847 CTGCCACTGCAGAGTGACCCTGG - Intronic
939228222 2:139390527-139390549 CTTCCAGTCCAGAGGGTCACAGG - Intergenic
939425208 2:142026829-142026851 CTTCCAGTGCTGTTGGGACCAGG + Intronic
940659899 2:156533162-156533184 CTTCCTGTCCAGAGTGAAACAGG + Intronic
940908170 2:159187094-159187116 CACCCAGGGCAGAGGGAAACAGG - Intronic
940971840 2:159904332-159904354 CTTCTGGTGCAGAGGGGACGCGG - Intronic
942018950 2:171847811-171847833 CTTCCATTGAAAAGGGAACTGGG + Intronic
944333756 2:198504084-198504106 CAACCAGTGCAAAGTGAACCTGG - Intronic
944539751 2:200743954-200743976 CATCCCGTGCAGAGGCATCCTGG + Intergenic
947119758 2:226801308-226801330 CTTGCACTGCAGAGGGAAGGTGG + Intergenic
948205816 2:236162414-236162436 CTTCCAGTGCAGGTGGGTCCCGG + Intergenic
948306986 2:236955666-236955688 TTTGCAGAGCAGAGGGAACGGGG - Intergenic
948712364 2:239833160-239833182 CTTCCAGTTCCGAGGAAAGCGGG + Intergenic
948974998 2:241458488-241458510 CTTCCACTCCAGTGGGATCCAGG - Intronic
1168806608 20:675538-675560 CTTCCAGTGCAGCGGGGTGCCGG - Exonic
1170372261 20:15662149-15662171 ATTTCAGTGCAGTGGGAACTGGG - Intronic
1172544176 20:35746548-35746570 AATCAAGTGCAGAAGGAACCTGG - Intergenic
1172707547 20:36893426-36893448 CTTTTATTGCAGAGGGGACCAGG - Exonic
1172943923 20:38673833-38673855 TTTCCAAGGCAGAGGGAATCAGG + Intergenic
1173054350 20:39596978-39597000 CCCTCAGTGTAGAGGGAACCTGG + Intergenic
1173907965 20:46642508-46642530 CTTCCAGTGCACAGCGACCCAGG - Intronic
1175251097 20:57610672-57610694 GTTCCAGTGCAGTGGGAAGCAGG - Intronic
1175525152 20:59628683-59628705 CTTCCAGAGCACAGGCAACAGGG - Intronic
1175709357 20:61206741-61206763 CTTTCAGTTAAGAGGGAAACAGG + Intergenic
1176419057 21:6499495-6499517 CTGGCAGTGCAGACCGAACCCGG + Intergenic
1177385024 21:20397298-20397320 CTTTCAGTGCAGAGGGGAGTTGG + Intergenic
1178466545 21:32853650-32853672 CTCTCAGTGGAGAGGGAACATGG + Intergenic
1178736987 21:35161380-35161402 CTTACATTTCAAAGGGAACCTGG - Intronic
1178911868 21:36681165-36681187 CTGCCAGAGAAGAGGGACCCTGG + Intergenic
1179423674 21:41255580-41255602 CTTCCAATCTAGGGGGAACCAGG - Intronic
1179694550 21:43107817-43107839 CTGGCAGTGCAGACCGAACCCGG + Intergenic
1180204542 21:46250020-46250042 GTTCCAGGACAGAGGGAACATGG + Intronic
1181628942 22:24140377-24140399 CTCCCTGAGCAGAGGGGACCAGG + Intronic
1181806223 22:25375936-25375958 CATCCAGTGCAGAGTGTCCCCGG + Intronic
1183773689 22:39948460-39948482 CTTCCATTACAAAGAGAACCTGG + Intronic
1184301447 22:43563129-43563151 CTGCCAGGGCAGAAGGAACGCGG + Intronic
950698895 3:14726412-14726434 CATCCACTGCAGAGGGAGGCCGG + Intronic
954464047 3:50644296-50644318 ATCCCAGTGCAGAAGGAGCCAGG - Intronic
955607357 3:60720115-60720137 CTTCTGGAGCAGAGGAAACCAGG - Intronic
956536162 3:70279576-70279598 CTCCCAGTCCAGACGGAATCTGG + Intergenic
957255325 3:77828376-77828398 CTTCCAGGGAAGAGTTAACCTGG - Intergenic
957465608 3:80586335-80586357 TTCCCAGTGGAGAGGGAACAGGG - Intergenic
957924642 3:86792687-86792709 CTTCTAGTGGAAAGGGTACCTGG + Intergenic
960131080 3:114056744-114056766 CCTCCAGTGCAGAGCCAATCAGG - Exonic
961340528 3:126214069-126214091 CTCCCATTGCAGGGGGATCCAGG - Intergenic
964656232 3:159068908-159068930 ATCCCAGTGCAGAGGTAAACTGG - Intronic
968517238 4:1020582-1020604 CTTCCAGCCCAGAGGCACCCAGG + Intronic
968534493 4:1114224-1114246 CTTCCGTTTCAGAGGGAAGCAGG - Intergenic
968751808 4:2393937-2393959 CTTCTAGTCCAGAGAGACCCAGG - Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
971381157 4:26099194-26099216 TTTCCTGTACAGAGGGCACCAGG - Intergenic
972305549 4:37826697-37826719 CTACCGCTGCAGAGGGAAGCAGG - Exonic
972365798 4:38373216-38373238 CTGGCAGTGCAGAGTGGACCTGG - Intergenic
972740144 4:41880676-41880698 ATTCCCGTGCTCAGGGAACCTGG + Intergenic
973719094 4:53705372-53705394 GTTCCTGTGCAGAGGGAAGGAGG + Intronic
975276317 4:72505827-72505849 CTTCCTATGCAGAGAGATCCTGG - Intronic
975735047 4:77372817-77372839 CTTCCAGTTCTTAGGGAAACTGG + Intronic
977582737 4:98743410-98743432 CTTCCACTGCGGAAGGGACCTGG + Intergenic
985760560 5:1746599-1746621 CTTCCCGTCCACAGGGAAACGGG - Intergenic
986190467 5:5492219-5492241 CTTTCAGTGCAGAGGTAAGCAGG + Intergenic
986395666 5:7327149-7327171 CTTCCTGTGCACATGGATCCTGG + Intergenic
986772841 5:10989163-10989185 CTGCCAGTGCAGAGGGGCACTGG + Intronic
986911078 5:12558146-12558168 CTTTCAGTGCAGTGAGCACCAGG - Intergenic
987090183 5:14503432-14503454 CTTCCAGTGCAGTGGGCAGATGG + Intronic
988782733 5:34538140-34538162 CTTTCAGTGGAGAGGGGACAGGG + Intergenic
994939980 5:106310808-106310830 GTTCCAGTGCACATGGACCCTGG - Intergenic
997813374 5:136993737-136993759 CTACCAGTGCAGAGGGAGCCTGG + Intronic
1002214286 5:177618771-177618793 GTTCCAGAGAGGAGGGAACCTGG + Intergenic
1002471481 5:179438496-179438518 CTGGCAGTGAAGAGGGATCCTGG - Intergenic
1002874482 6:1199531-1199553 CCTCCAGTGGAGAGAGACCCAGG + Intergenic
1005636324 6:27756921-27756943 CTTCTAGTGCAGAGGGTCTCTGG + Intergenic
1006316646 6:33295580-33295602 CTTCCACTGGAGAGGGACCTGGG - Exonic
1007180518 6:39926156-39926178 CTTCCTGGGCTGAGGGCACCTGG + Intronic
1007301166 6:40868929-40868951 CTCCCAGTACAGAGGGGCCCAGG - Intergenic
1007313054 6:40961950-40961972 CATCCAGAGCGGAGGGAAGCTGG - Intergenic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1009811539 6:68673858-68673880 CTTCAAATGCAGAGGGAATAGGG + Intronic
1009923499 6:70092300-70092322 CCTCCACTCCAGAGGGAAACTGG + Intronic
1011075279 6:83431434-83431456 CTTCCCGGGCAGGGGGATCCTGG - Intergenic
1011699695 6:89943965-89943987 ATTCCAGTGCTGCTGGAACCAGG + Intronic
1011748452 6:90431821-90431843 ATTCCAGTGCAGTGGGAAACAGG - Intergenic
1012749500 6:103140101-103140123 CTCTCAGTGGAGAGGAAACCTGG + Intergenic
1015380621 6:132563353-132563375 CATCCAGTGCAGGAGGGACCAGG - Intergenic
1015886478 6:137923483-137923505 CTTCCAGTAGAGAAAGAACCAGG + Intergenic
1016339437 6:143046279-143046301 CTTCTAAAACAGAGGGAACCAGG + Intergenic
1018794941 6:167178556-167178578 CTGCCAGTGTAGAGTGACCCAGG - Intronic
1018821378 6:167376510-167376532 CTGCCAGTGTAGAGTGACCCAGG + Intronic
1018872544 6:167794588-167794610 CTCCCAGTGTGGTGGGAACCAGG - Intronic
1021819274 7:24480183-24480205 CTTCCAGAGCAGGGGGAAATAGG - Intergenic
1025062580 7:55823372-55823394 CTCTCAGTGGAGAGGGGACCTGG - Intronic
1025618224 7:63142986-63143008 CTTTCAGTGGAGAGGGGACCTGG - Intergenic
1028694332 7:93691317-93691339 GTTCAAGTGCAGAGAGATCCTGG - Intronic
1033166474 7:139042805-139042827 CTTTCAGTGGAGAGGGAGCAGGG - Intergenic
1035377344 7:158414171-158414193 CTTCCAGAGCGTAGGGAATCAGG + Intronic
1037793610 8:21971338-21971360 CTTCCAGGGCTGAGGTAAGCAGG - Intronic
1037981846 8:23259891-23259913 CTTCAAGGGCAGTGGGAATCAGG + Intronic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1043438961 8:80260214-80260236 CTTTCAGTGAAGAGGGGAGCTGG + Intergenic
1047431702 8:124798713-124798735 CTTCCAGAGAAGAGGGAACCTGG - Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1048330556 8:133467777-133467799 CTTCCATTGCAGTGGGGACTGGG - Intronic
1049634827 8:143682057-143682079 CTTTCAGTGGAGAGGGGACATGG + Intergenic
1052998847 9:34566177-34566199 GTTCCAGTGCAGAGCAAAGCAGG - Intronic
1053380945 9:37649764-37649786 CTGCCAGTGCACTGGGAACACGG + Intronic
1055145667 9:72931693-72931715 CCTCTTGTGCAGAGGGAACAGGG + Intronic
1055486692 9:76763169-76763191 CTTCCAGTGCAGGCAGCACCTGG - Intronic
1057455186 9:95202267-95202289 ATGCCAGGGCAGAGGGAACTGGG + Intronic
1059049593 9:110909413-110909435 CTTTCAGTGCAGTGGGCAGCAGG + Intronic
1059929243 9:119244648-119244670 TTCTCAGTCCAGAGGGAACCGGG - Intronic
1060310057 9:122451830-122451852 CCCCCAGACCAGAGGGAACCTGG - Intergenic
1061753658 9:132798058-132798080 CTCCCAGCGCACAGGGATCCTGG + Intronic
1190411399 X:50140434-50140456 CTTCAAGTCCAGAGGGAACAAGG - Intergenic
1190688873 X:52897336-52897358 TTTCCAGGGCAGAGGAAACGAGG + Intronic
1190697110 X:52958456-52958478 TTTCCAGGGCAGAGGAAACGAGG - Exonic
1192554288 X:72077716-72077738 CCTCCAGCCCAGAGGGATCCGGG + Intergenic
1196873142 X:120131510-120131532 CTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1197073273 X:122325948-122325970 CTTCCAGGGGACAGAGAACCAGG + Intergenic
1200091659 X:153638843-153638865 CGTCCAGGGCTAAGGGAACCAGG - Intergenic