ID: 1039533252

View in Genome Browser
Species Human (GRCh38)
Location 8:38283801-38283823
Sequence TGGAATTCAGTTAGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039533250_1039533252 27 Left 1039533250 8:38283751-38283773 CCACTGGCTTTTTCTCTCTCTTG 0: 1
1: 0
2: 10
3: 125
4: 1210
Right 1039533252 8:38283801-38283823 TGGAATTCAGTTAGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039533252 Original CRISPR TGGAATTCAGTTAGAAAAAC AGG Intronic
No off target data available for this crispr